Incidental Mutation 'R4955:Fstl5'
ID381520
Institutional Source Beutler Lab
Gene Symbol Fstl5
Ensembl Gene ENSMUSG00000034098
Gene Namefollistatin-like 5
Synonyms9130207J01Rik
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location76074270-76710019 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 76223876 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038364] [ENSMUST00000160261] [ENSMUST00000160261]
Predicted Effect probably null
Transcript: ENSMUST00000038364
SMART Domains Protein: ENSMUSP00000038506
Gene: ENSMUSG00000034098

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159686
Predicted Effect probably null
Transcript: ENSMUST00000160261
SMART Domains Protein: ENSMUSP00000125393
Gene: ENSMUSG00000034098

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160261
SMART Domains Protein: ENSMUSP00000125393
Gene: ENSMUSG00000034098

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Fstl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Fstl5 APN 3 76707828 missense probably benign 0.30
IGL01658:Fstl5 APN 3 76482255 missense possibly damaging 0.70
IGL01917:Fstl5 APN 3 76707846 missense probably damaging 1.00
IGL02073:Fstl5 APN 3 76659652 splice site probably benign
IGL02329:Fstl5 APN 3 76588995 missense probably damaging 1.00
IGL02651:Fstl5 APN 3 76593534 missense probably damaging 1.00
IGL02967:Fstl5 APN 3 76322191 missense probably damaging 1.00
IGL03004:Fstl5 APN 3 76648431 splice site probably benign
IGL03107:Fstl5 APN 3 76536311 missense probably damaging 1.00
IGL03113:Fstl5 APN 3 76429792 nonsense probably null
P0038:Fstl5 UTSW 3 76145062 missense probably damaging 1.00
PIT4131001:Fstl5 UTSW 3 76659699 missense probably damaging 0.99
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0078:Fstl5 UTSW 3 76659645 splice site probably benign
R0137:Fstl5 UTSW 3 76707479 missense probably damaging 1.00
R0183:Fstl5 UTSW 3 76322272 missense possibly damaging 0.86
R0330:Fstl5 UTSW 3 76707753 missense possibly damaging 0.80
R0427:Fstl5 UTSW 3 76707727 nonsense probably null
R0687:Fstl5 UTSW 3 76707812 missense possibly damaging 0.62
R1642:Fstl5 UTSW 3 76410622 missense possibly damaging 0.80
R1765:Fstl5 UTSW 3 76593476 missense possibly damaging 0.90
R1900:Fstl5 UTSW 3 76708160 missense probably damaging 1.00
R1996:Fstl5 UTSW 3 76707834 missense probably benign 0.19
R2157:Fstl5 UTSW 3 76708065 missense possibly damaging 0.46
R2228:Fstl5 UTSW 3 76482352 missense probably damaging 1.00
R2851:Fstl5 UTSW 3 76429738 splice site probably benign
R4021:Fstl5 UTSW 3 76628975 missense probably benign 0.00
R4086:Fstl5 UTSW 3 76648286 missense probably damaging 1.00
R4777:Fstl5 UTSW 3 76593500 missense probably damaging 1.00
R4829:Fstl5 UTSW 3 76322182 missense probably damaging 1.00
R4934:Fstl5 UTSW 3 76588965 missense probably damaging 1.00
R4977:Fstl5 UTSW 3 76410494 nonsense probably null
R5166:Fstl5 UTSW 3 76628960 missense possibly damaging 0.86
R5232:Fstl5 UTSW 3 76144977 missense possibly damaging 0.89
R5313:Fstl5 UTSW 3 76593505 missense possibly damaging 0.90
R5584:Fstl5 UTSW 3 76322267 missense probably damaging 1.00
R5647:Fstl5 UTSW 3 76589092 missense probably damaging 1.00
R5842:Fstl5 UTSW 3 76322283 missense possibly damaging 0.94
R5978:Fstl5 UTSW 3 76145085 missense probably damaging 1.00
R6007:Fstl5 UTSW 3 76410592 missense probably damaging 1.00
R6064:Fstl5 UTSW 3 76322298 missense probably benign 0.13
R6327:Fstl5 UTSW 3 76707801 missense probably benign 0.31
R6386:Fstl5 UTSW 3 76322066 missense probably benign 0.13
R6523:Fstl5 UTSW 3 76536334 missense probably benign 0.00
R6852:Fstl5 UTSW 3 76707855 missense probably damaging 1.00
R6861:Fstl5 UTSW 3 76322216 missense probably damaging 1.00
R6866:Fstl5 UTSW 3 76322225 missense probably damaging 0.99
R7100:Fstl5 UTSW 3 76536293 missense probably benign 0.11
R7341:Fstl5 UTSW 3 76482397 splice site probably null
R7495:Fstl5 UTSW 3 76707792 missense possibly damaging 0.85
R7558:Fstl5 UTSW 3 76429785 missense possibly damaging 0.95
R7731:Fstl5 UTSW 3 76661762 missense probably damaging 1.00
R7787:Fstl5 UTSW 3 76429824 missense probably damaging 1.00
R7852:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7874:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7881:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R7935:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7957:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7964:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R8039:Fstl5 UTSW 3 76648418 missense possibly damaging 0.69
R8050:Fstl5 UTSW 3 76707503 missense probably benign 0.00
Z1176:Fstl5 UTSW 3 76707982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTACAGATATATGTGCACCAAGAG -3'
(R):5'- ACAATGGTTGGGGTGGTAATCTTAC -3'

Sequencing Primer
(F):5'- CGATAAATCTTTGTACGAGC -3'
(R):5'- CCTGGATCATTCTGTGAAGAAAG -3'
Posted On2016-04-27