Incidental Mutation 'R4955:Ing4'
ID381528
Institutional Source Beutler Lab
Gene Symbol Ing4
Ensembl Gene ENSMUSG00000030330
Gene Nameinhibitor of growth family, member 4
Synonymsp29ING4, D6Wsu147e, D6Xrf92
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125039760-125049265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125048201 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 225 (A225V)
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000032481] [ENSMUST00000088294] [ENSMUST00000112413] [ENSMUST00000112414] [ENSMUST00000112417] [ENSMUST00000140131]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032480
AA Change: A224V

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330
AA Change: A224V

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032481
SMART Domains Protein: ENSMUSP00000032481
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 140 4.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088294
SMART Domains Protein: ENSMUSP00000085632
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.6e-139 PFAM
KAZAL 466 506 1.42e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112412
SMART Domains Protein: ENSMUSP00000108031
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 87 6.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112413
SMART Domains Protein: ENSMUSP00000108032
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 169 6.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112414
SMART Domains Protein: ENSMUSP00000108033
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133695
Predicted Effect probably damaging
Transcript: ENSMUST00000140131
AA Change: A225V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330
AA Change: A225V

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140883
SMART Domains Protein: ENSMUSP00000118561
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151125
SMART Domains Protein: ENSMUSP00000119709
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1.4e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
PDB:1WEU|A 167 216 3e-32 PDB
SCOP:d1fp0a1 190 216 2e-3 SMART
Blast:PHD 197 215 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205110
Meta Mutation Damage Score 0.4078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. Multiple alternatively spliced transcript variants have been observed that encode distinct proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are hypersensitive to LPS challenge and exhibit elevated cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Ing4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Ing4 APN 6 125043986 missense possibly damaging 0.95
R0361:Ing4 UTSW 6 125047894 missense probably damaging 1.00
R0830:Ing4 UTSW 6 125043960 missense probably damaging 1.00
R2969:Ing4 UTSW 6 125047325 missense probably benign 0.01
R4849:Ing4 UTSW 6 125043983 missense probably damaging 0.98
R4971:Ing4 UTSW 6 125043998 missense probably benign 0.01
R5141:Ing4 UTSW 6 125039874 missense probably benign
R5561:Ing4 UTSW 6 125047060 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GATGTGAGAACCGTTTCCTCG -3'
(R):5'- GCGTGGGCAAAACCTAAAAC -3'

Sequencing Primer
(F):5'- CTCTGAGGGGCATGAGTAAG -3'
(R):5'- CTAAAACCCAACATGAAGGAGAG -3'
Posted On2016-04-27