Incidental Mutation 'R4955:Arl2bp'
ID381531
Institutional Source Beutler Lab
Gene Symbol Arl2bp
Ensembl Gene ENSMUSG00000031776
Gene NameADP-ribosylation factor-like 2 binding protein
Synonyms1700027H16Rik, Bart1, BART, 1700010P10Rik
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94666600-94674425 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 94670428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034227] [ENSMUST00000034228] [ENSMUST00000109527] [ENSMUST00000211858] [ENSMUST00000211858]
Predicted Effect probably benign
Transcript: ENSMUST00000034227
SMART Domains Protein: ENSMUSP00000034227
Gene: ENSMUSG00000031775

DomainStartEndE-ValueType
Pfam:MARVEL 32 160 6.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034228
SMART Domains Protein: ENSMUSP00000034228
Gene: ENSMUSG00000031776

DomainStartEndE-ValueType
Pfam:ARL2_Bind_BART 20 134 3.8e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109527
SMART Domains Protein: ENSMUSP00000105153
Gene: ENSMUSG00000031776

DomainStartEndE-ValueType
Pfam:ARL2_Bind_BART 5 125 1e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211858
Predicted Effect probably null
Transcript: ENSMUST00000211858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212877
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. The protein encoded by this gene binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of this protein or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. This protein is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Arl2bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4031:Arl2bp UTSW 8 94667653 missense probably damaging 1.00
R7071:Arl2bp UTSW 8 94667166 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTTATAAGCCTGGCAAGTGC -3'
(R):5'- GCTCCAAGATCTGGCAAGAG -3'

Sequencing Primer
(F):5'- CCTGGCAAGTGCTTACTTTAAAAGG -3'
(R):5'- CTCAGGCAGGCTTCTAACTTGAAG -3'
Posted On2016-04-27