Incidental Mutation 'R4955:Nqo1'
ID381532
Institutional Source Beutler Lab
Gene Symbol Nqo1
Ensembl Gene ENSMUSG00000003849
Gene NameNAD(P)H dehydrogenase, quinone 1
SynonymsDia4, NQO1, NAD(P)H dehydrogenase (quinone), Ox1, QR1, Ox-1, NMO1, Nmor1
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location107388225-107403206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107388857 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 263 (S263P)
Ref Sequence ENSEMBL: ENSMUSP00000003947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003947]
PDB Structure
CRYSTAL STRUCTURE OF MOUSE NAD[P]H-QUINONE OXIDOREDUCTASE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003947
AA Change: S263P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003947
Gene: ENSMUSG00000003849
AA Change: S263P

DomainStartEndE-ValueType
Pfam:FMN_red 4 174 6e-11 PFAM
Pfam:Flavodoxin_2 4 212 9.7e-52 PFAM
low complexity region 240 251 N/A INTRINSIC
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of this protein has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null mice display increased toxicity to menadione, insulin resistance, an altered intracellular redox status, as well as decreased pyridine nucleotide synthesis, gluconeogenesis and fatty acid metabolism, leading to reduced quantities of abdominal adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Nqo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Nqo1 APN 8 107388955 missense probably benign 0.21
IGL02711:Nqo1 APN 8 107392931 missense probably damaging 1.00
R2289:Nqo1 UTSW 8 107392998 missense probably benign 0.42
R3011:Nqo1 UTSW 8 107389111 missense probably benign
R4419:Nqo1 UTSW 8 107392117 splice site probably null
R4420:Nqo1 UTSW 8 107392117 splice site probably null
R4659:Nqo1 UTSW 8 107391044 critical splice donor site probably null
R4832:Nqo1 UTSW 8 107388845 missense probably benign 0.27
R6018:Nqo1 UTSW 8 107388868 missense probably damaging 1.00
R6320:Nqo1 UTSW 8 107388950 missense probably benign 0.00
R7184:Nqo1 UTSW 8 107392647 missense probably damaging 1.00
R7301:Nqo1 UTSW 8 107392648 missense probably damaging 1.00
R7473:Nqo1 UTSW 8 107403097 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGCTCCTAATCTGACTTCATTC -3'
(R):5'- TACAGCATTGGCCACACTCC -3'

Sequencing Primer
(F):5'- CATTCATTTTGTTGTTATGGCAGAAC -3'
(R):5'- AGATGCCCGCATGCAGATC -3'
Posted On2016-04-27