Incidental Mutation 'R4955:Lrfn5'
ID381542
Institutional Source Beutler Lab
Gene Symbol Lrfn5
Ensembl Gene ENSMUSG00000035653
Gene Nameleucine rich repeat and fibronectin type III domain containing 5
Synonyms
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location61523150-61858342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 61839978 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 184 (D184A)
Ref Sequence ENSEMBL: ENSMUSP00000113123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055815] [ENSMUST00000119481]
Predicted Effect probably benign
Transcript: ENSMUST00000055815
AA Change: D184A

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051546
Gene: ENSMUSG00000035653
AA Change: D184A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119481
AA Change: D184A

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113123
Gene: ENSMUSG00000035653
AA Change: D184A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Meta Mutation Damage Score 0.1271 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Lrfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Lrfn5 APN 12 61844126 missense probably benign
IGL02010:Lrfn5 APN 12 61839683 missense probably damaging 0.96
IGL03033:Lrfn5 APN 12 61840047 missense probably damaging 1.00
IGL03094:Lrfn5 APN 12 61839746 missense probably benign 0.00
IGL03207:Lrfn5 APN 12 61843326 missense probably damaging 1.00
falstaffian UTSW 12 61843562 missense probably benign 0.21
PIT4696001:Lrfn5 UTSW 12 61843557 missense probably damaging 1.00
R0402:Lrfn5 UTSW 12 61840017 missense probably benign 0.22
R0738:Lrfn5 UTSW 12 61840592 nonsense probably null
R0744:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0833:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0974:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R1073:Lrfn5 UTSW 12 61840809 missense probably damaging 1.00
R1332:Lrfn5 UTSW 12 61857528 splice site probably benign
R1500:Lrfn5 UTSW 12 61839741 missense probably damaging 1.00
R2039:Lrfn5 UTSW 12 61840323 missense possibly damaging 0.82
R3834:Lrfn5 UTSW 12 61840030 missense probably damaging 1.00
R4171:Lrfn5 UTSW 12 61843382 missense probably damaging 1.00
R4212:Lrfn5 UTSW 12 61843820 missense probably benign
R4394:Lrfn5 UTSW 12 61843490 missense probably damaging 1.00
R4578:Lrfn5 UTSW 12 61843977 missense probably benign
R4661:Lrfn5 UTSW 12 61839647 missense probably damaging 1.00
R4730:Lrfn5 UTSW 12 61840719 missense probably benign 0.03
R4968:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R4970:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R5078:Lrfn5 UTSW 12 61843874 missense possibly damaging 0.47
R5165:Lrfn5 UTSW 12 61839624 missense possibly damaging 0.89
R5768:Lrfn5 UTSW 12 61839723 missense probably benign 0.44
R5892:Lrfn5 UTSW 12 61843418 missense probably damaging 1.00
R6133:Lrfn5 UTSW 12 61843788 missense probably benign 0.22
R6211:Lrfn5 UTSW 12 61839470 missense probably benign 0.00
R6297:Lrfn5 UTSW 12 61843562 missense probably benign 0.21
R6341:Lrfn5 UTSW 12 61843582 nonsense probably null
R6861:Lrfn5 UTSW 12 61839690 missense probably damaging 1.00
R7179:Lrfn5 UTSW 12 61843982 missense probably benign
R7392:Lrfn5 UTSW 12 61840304 missense probably benign 0.00
Z1177:Lrfn5 UTSW 12 61839817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTGCATTTGAATAGCAAC -3'
(R):5'- GGGGTTTCCACCAAAACTCAATG -3'

Sequencing Primer
(F):5'- CAAATGATATGTTCAGTGGGCTTTCC -3'
(R):5'- GCAAAAGTCGATGGGCTTATGATTCC -3'
Posted On2016-04-27