Incidental Mutation 'R4955:Hist1h4i'
ID381544
Institutional Source Beutler Lab
Gene Symbol Hist1h4i
Ensembl Gene ENSMUSG00000060639
Gene Namehistone cluster 1, H4i
Synonyms
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22040636-22041362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22041185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000100042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091741] [ENSMUST00000102977] [ENSMUST00000110452] [ENSMUST00000110455]
Predicted Effect probably benign
Transcript: ENSMUST00000091741
SMART Domains Protein: ENSMUSP00000089335
Gene: ENSMUSG00000069301

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102977
AA Change: I47F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100042
Gene: ENSMUSG00000060639
AA Change: I47F

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110452
SMART Domains Protein: ENSMUSP00000106082
Gene: ENSMUSG00000069300

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110455
SMART Domains Protein: ENSMUSP00000106085
Gene: ENSMUSG00000062727

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198508
Meta Mutation Damage Score 0.3149 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Hist1h4i
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0632:Hist1h4i UTSW 13 22041027 nonsense probably null
R0676:Hist1h4i UTSW 13 22041106 unclassified probably null
R6174:Hist1h4i UTSW 13 22041077 missense probably benign 0.41
R7556:Hist1h4i UTSW 13 22041244 missense probably damaging 1.00
Z1176:Hist1h4i UTSW 13 22041214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGAGCAGCTTAACCGC -3'
(R):5'- CCGCAAGTTCCCTATAAGAGG -3'

Sequencing Primer
(F):5'- GCCGAACCCGTACAGAG -3'
(R):5'- TATAAGAGGGACCGGCCTTC -3'
Posted On2016-04-27