Incidental Mutation 'R4955:Opn5'
ID381552
Institutional Source Beutler Lab
Gene Symbol Opn5
Ensembl Gene ENSMUSG00000043972
Gene Nameopsin 5
SynonymsGpr136, Neuropsin, TMEM13, PGR12
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42556783-42611313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42611238 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 24 (F24L)
Ref Sequence ENSEMBL: ENSMUSP00000063542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068355]
Predicted Effect probably damaging
Transcript: ENSMUST00000068355
AA Change: F24L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063542
Gene: ENSMUSG00000043972
AA Change: F24L

DomainStartEndE-ValueType
Pfam:7tm_1 50 306 3.4e-41 PFAM
Meta Mutation Damage Score 0.3306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This opsin gene is expressed in the eye, brain, testes, and spinal cord. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes peropsin (RRH) and retinal G protein coupled receptor (RGR). Like these other seven-exon opsin genes, this family member may encode a protein with photoisomerase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit light/dark entrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Rcan2 C A 17: 44,037,081 P13Q probably damaging Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Opn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Opn5 APN 17 42611228 missense probably damaging 1.00
IGL01372:Opn5 APN 17 42580544 splice site probably null
IGL01554:Opn5 APN 17 42607198 missense probably damaging 0.99
IGL02363:Opn5 APN 17 42557491 missense probably benign
IGL02421:Opn5 APN 17 42596555 splice site probably benign
IGL02720:Opn5 APN 17 42596626 missense probably damaging 1.00
K7371:Opn5 UTSW 17 42580631 missense probably damaging 1.00
R0063:Opn5 UTSW 17 42596626 missense probably damaging 1.00
R0220:Opn5 UTSW 17 42596604 missense probably benign 0.04
R0505:Opn5 UTSW 17 42592953 missense possibly damaging 0.88
R0971:Opn5 UTSW 17 42611327 unclassified probably null
R2035:Opn5 UTSW 17 42607161 missense probably damaging 0.97
R4723:Opn5 UTSW 17 42607200 missense probably damaging 1.00
R4830:Opn5 UTSW 17 42611296 missense probably benign 0.00
R4874:Opn5 UTSW 17 42580719 missense probably damaging 1.00
R5813:Opn5 UTSW 17 42593006 missense probably damaging 0.99
R5924:Opn5 UTSW 17 42611308 start codon destroyed probably null 0.95
R6478:Opn5 UTSW 17 42580749 missense probably benign 0.06
R7831:Opn5 UTSW 17 42580619 missense probably null 0.85
R7914:Opn5 UTSW 17 42580619 missense probably null 0.85
Z1177:Opn5 UTSW 17 42596599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACAATGCCAATTCACCTTC -3'
(R):5'- TACCAATCACCTGTGGGACC -3'

Sequencing Primer
(F):5'- AATGCCAATTCACCTTCTCCAC -3'
(R):5'- TGGGACCCTGGAGTTTGCC -3'
Posted On2016-04-27