Incidental Mutation 'R4955:Rcan2'
ID381553
Institutional Source Beutler Lab
Gene Symbol Rcan2
Ensembl Gene ENSMUSG00000039601
Gene Nameregulator of calcineurin 2
SynonymsCsp2, ZAKI-4, MCIP2, Dscr1l1
MMRRC Submission 042552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4955 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43801351-44039516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44037081 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 13 (P13Q)
Ref Sequence ENSEMBL: ENSMUSP00000155543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044792] [ENSMUST00000044895] [ENSMUST00000177857] [ENSMUST00000228972] [ENSMUST00000229744] [ENSMUST00000229939]
Predicted Effect probably benign
Transcript: ENSMUST00000044792
AA Change: P181Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048013
Gene: ENSMUSG00000039601
AA Change: P181Q

DomainStartEndE-ValueType
Pfam:Calcipressin 20 191 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044895
AA Change: P227Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039473
Gene: ENSMUSG00000039601
AA Change: P227Q

DomainStartEndE-ValueType
Pfam:Calcipressin 66 237 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177857
AA Change: P181Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137211
Gene: ENSMUSG00000039601
AA Change: P181Q

DomainStartEndE-ValueType
Pfam:Calcipressin 20 191 2.1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228972
AA Change: P227Q

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000229744
AA Change: P227Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000229939
AA Change: P13Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out alle exhibit decreased body weight and resistance to diet-induced obesity, steatosis, glucose intolerance, and insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4933407L21Rik T A 1: 85,931,287 probably benign Het
Abca8a T G 11: 110,036,512 E1338D probably benign Het
Arl2bp G A 8: 94,670,428 probably null Het
Arsj T C 3: 126,438,540 Y312H probably benign Het
Atp8b2 G T 3: 89,952,920 probably benign Het
Cdh20 T C 1: 104,984,803 V594A probably damaging Het
Cfap44 T A 16: 44,475,277 V1646E possibly damaging Het
Csmd3 A T 15: 48,673,518 I96K probably damaging Het
Dusp27 T C 1: 166,108,092 Y179C probably damaging Het
Fbn2 T C 18: 58,058,383 Q1556R possibly damaging Het
Fstl5 T A 3: 76,223,876 probably null Het
Hist1h4i T A 13: 22,041,185 I47F probably damaging Het
Hivep2 T A 10: 14,130,958 M1100K probably benign Het
Ing4 C T 6: 125,048,201 A225V probably damaging Het
Kcnc3 CTT CT 7: 44,591,296 probably null Het
Khdrbs2 T A 1: 32,520,077 probably benign Het
Kif21a A T 15: 90,937,190 W1566R probably damaging Het
Lrfn5 A C 12: 61,839,978 D184A probably benign Het
Mettl2 C T 11: 105,137,779 T319I possibly damaging Het
Mgrn1 T C 16: 4,934,219 V529A probably benign Het
Naca T A 10: 128,042,215 probably benign Het
Ninj2 A G 6: 120,197,946 N26S probably damaging Het
Nqo1 A G 8: 107,388,857 S263P probably benign Het
Obscn T C 11: 59,069,172 T3566A probably benign Het
Olfr1287 A T 2: 111,449,605 H155L probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr243 A T 7: 103,716,705 Y37F probably benign Het
Olfr761 T C 17: 37,952,898 N42S probably damaging Het
Opn5 A T 17: 42,611,238 F24L probably damaging Het
Palmd A G 3: 116,924,224 V208A probably damaging Het
Plekhd1 T A 12: 80,722,021 I426N possibly damaging Het
Polq T G 16: 37,061,082 Y1203D probably benign Het
Prex1 A G 2: 166,573,223 F251S probably damaging Het
Prkd3 T C 17: 78,952,727 M816V probably null Het
Rab3gap2 C T 1: 185,267,155 probably benign Het
Slc35b3 A G 13: 38,932,890 V329A probably benign Het
Slc5a1 T C 5: 33,160,902 M633T probably benign Het
Stac2 A C 11: 98,043,548 L110R possibly damaging Het
Tecpr1 T C 5: 144,217,257 E126G probably damaging Het
Ttll6 A G 11: 96,138,789 D176G possibly damaging Het
Utrn C T 10: 12,861,567 probably null Het
Zfp341 T C 2: 154,638,030 V467A probably damaging Het
Other mutations in Rcan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Rcan2 APN 17 44037069 missense possibly damaging 0.61
IGL00430:Rcan2 APN 17 43836384 missense probably benign 0.08
IGL00958:Rcan2 APN 17 44037017 missense probably damaging 1.00
IGL01121:Rcan2 APN 17 44017884 missense probably damaging 0.99
IGL01397:Rcan2 APN 17 43836468 missense possibly damaging 0.56
IGL01897:Rcan2 APN 17 43836434 missense probably damaging 0.99
R1510:Rcan2 UTSW 17 43836424 missense probably damaging 1.00
R1803:Rcan2 UTSW 17 44037033 missense probably damaging 1.00
R1862:Rcan2 UTSW 17 44037089 unclassified probably null
R3841:Rcan2 UTSW 17 44036979 missense probably benign 0.25
R4241:Rcan2 UTSW 17 43953479 missense probably benign 0.03
R4402:Rcan2 UTSW 17 43953470 missense probably benign 0.00
R5014:Rcan2 UTSW 17 44017813 missense probably damaging 1.00
R5470:Rcan2 UTSW 17 43836283 missense probably benign 0.02
R5555:Rcan2 UTSW 17 44037030 missense probably damaging 1.00
R6393:Rcan2 UTSW 17 43953479 missense probably benign 0.03
R6478:Rcan2 UTSW 17 43836334 missense probably benign
R7007:Rcan2 UTSW 17 43836325 missense probably benign
R7307:Rcan2 UTSW 17 44021102 nonsense probably null
R7602:Rcan2 UTSW 17 44017798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAAGCAGCTTTTAAGACTCTTTCC -3'
(R):5'- GGAAGGATTCGCAAACAACCAA -3'

Sequencing Primer
(F):5'- GCCTGCCCTTTTCTGAAGAGAAATG -3'
(R):5'- AACACCCAGGGACTTAAAGG -3'
Posted On2016-04-27