Mutagenetix > Incidental Mutations

Incidental Mutation 'R4955:Rcan2'

381553

Institutional Source

Beutler Lab

Gene Symbol

Rcan2

Ensembl Gene

ENSMUSG00000039601

Gene Name

regulator of calcineurin 2

Synonyms

Csp2, ZAKI-4, MCIP2, Dscr1l1

MMRRC Submission

042552-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R4955 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43801351-44039516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 44037081 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 13 (P13Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044792] [ENSMUST00000044895] [ENSMUST00000177857] [ENSMUST00000228972] [ENSMUST00000229744] [ENSMUST00000229939]

Predicted Effect

probably benign
Transcript: ENSMUST00000044792
AA Change: P181Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000048013
Gene: ENSMUSG00000039601
AA Change: P181Q

Domain	Start	End	E-Value	Type
Pfam:Calcipressin	20	191	2.1e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000044895
AA Change: P227Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000039473
Gene: ENSMUSG00000039601
AA Change: P227Q

Domain	Start	End	E-Value	Type
Pfam:Calcipressin	66	237	1.3e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177857
AA Change: P181Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000137211
Gene: ENSMUSG00000039601
AA Change: P181Q

Domain	Start	End	E-Value	Type
Pfam:Calcipressin	20	191	2.1e-64	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228972
AA Change: P227Q

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000229744
AA Change: P227Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000229939
AA Change: P13Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.0945

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out alle exhibit decreased body weight and resistance to diet-induced obesity, steatosis, glucose intolerance, and insulin sensitivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
4933407L21Rik	T	A	1: 85,931,287		probably benign	Het
Abca8a	T	G	11: 110,036,512	E1338D	probably benign	Het
Arl2bp	G	A	8: 94,670,428		probably null	Het
Arsj	T	C	3: 126,438,540	Y312H	probably benign	Het
Atp8b2	G	T	3: 89,952,920		probably benign	Het
Cdh20	T	C	1: 104,984,803	V594A	probably damaging	Het
Cfap44	T	A	16: 44,475,277	V1646E	possibly damaging	Het
Csmd3	A	T	15: 48,673,518	I96K	probably damaging	Het
Dusp27	T	C	1: 166,108,092	Y179C	probably damaging	Het
Fbn2	T	C	18: 58,058,383	Q1556R	possibly damaging	Het
Fstl5	T	A	3: 76,223,876		probably null	Het
Hist1h4i	T	A	13: 22,041,185	I47F	probably damaging	Het
Hivep2	T	A	10: 14,130,958	M1100K	probably benign	Het
Ing4	C	T	6: 125,048,201	A225V	probably damaging	Het
Kcnc3	CTT	CT	7: 44,591,296		probably null	Het
Khdrbs2	T	A	1: 32,520,077		probably benign	Het
Kif21a	A	T	15: 90,937,190	W1566R	probably damaging	Het
Lrfn5	A	C	12: 61,839,978	D184A	probably benign	Het
Mettl2	C	T	11: 105,137,779	T319I	possibly damaging	Het
Mgrn1	T	C	16: 4,934,219	V529A	probably benign	Het
Naca	T	A	10: 128,042,215		probably benign	Het
Ninj2	A	G	6: 120,197,946	N26S	probably damaging	Het
Nqo1	A	G	8: 107,388,857	S263P	probably benign	Het
Obscn	T	C	11: 59,069,172	T3566A	probably benign	Het
Olfr1287	A	T	2: 111,449,605	H155L	probably damaging	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Olfr243	A	T	7: 103,716,705	Y37F	probably benign	Het
Olfr761	T	C	17: 37,952,898	N42S	probably damaging	Het
Opn5	A	T	17: 42,611,238	F24L	probably damaging	Het
Palmd	A	G	3: 116,924,224	V208A	probably damaging	Het
Plekhd1	T	A	12: 80,722,021	I426N	possibly damaging	Het
Polq	T	G	16: 37,061,082	Y1203D	probably benign	Het
Prex1	A	G	2: 166,573,223	F251S	probably damaging	Het
Prkd3	T	C	17: 78,952,727	M816V	probably null	Het
Rab3gap2	C	T	1: 185,267,155		probably benign	Het
Slc35b3	A	G	13: 38,932,890	V329A	probably benign	Het
Slc5a1	T	C	5: 33,160,902	M633T	probably benign	Het
Stac2	A	C	11: 98,043,548	L110R	possibly damaging	Het
Tecpr1	T	C	5: 144,217,257	E126G	probably damaging	Het
Ttll6	A	G	11: 96,138,789	D176G	possibly damaging	Het
Utrn	C	T	10: 12,861,567		probably null	Het
Zfp341	T	C	2: 154,638,030	V467A	probably damaging	Het

Other mutations in Rcan2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Rcan2	APN	17	44037069	missense	possibly damaging	0.61
IGL00430:Rcan2	APN	17	43836384	missense	probably benign	0.08
IGL00958:Rcan2	APN	17	44037017	missense	probably damaging	1.00
IGL01121:Rcan2	APN	17	44017884	missense	probably damaging	0.99
IGL01397:Rcan2	APN	17	43836468	missense	possibly damaging	0.56
IGL01897:Rcan2	APN	17	43836434	missense	probably damaging	0.99
R1510:Rcan2	UTSW	17	43836424	missense	probably damaging	1.00
R1803:Rcan2	UTSW	17	44037033	missense	probably damaging	1.00
R1862:Rcan2	UTSW	17	44037089	unclassified	probably null
R3841:Rcan2	UTSW	17	44036979	missense	probably benign	0.25
R4241:Rcan2	UTSW	17	43953479	missense	probably benign	0.03
R4402:Rcan2	UTSW	17	43953470	missense	probably benign	0.00
R5014:Rcan2	UTSW	17	44017813	missense	probably damaging	1.00
R5470:Rcan2	UTSW	17	43836283	missense	probably benign	0.02
R5555:Rcan2	UTSW	17	44037030	missense	probably damaging	1.00
R6393:Rcan2	UTSW	17	43953479	missense	probably benign	0.03
R6478:Rcan2	UTSW	17	43836334	missense	probably benign
R7007:Rcan2	UTSW	17	43836325	missense	probably benign
R7307:Rcan2	UTSW	17	44021102	nonsense	probably null
R7602:Rcan2	UTSW	17	44017798	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAAAGCAGCTTTTAAGACTCTTTCC -3'
(R):5'- GGAAGGATTCGCAAACAACCAA -3'

Sequencing Primer
(F):5'- GCCTGCCCTTTTCTGAAGAGAAATG -3'
(R):5'- AACACCCAGGGACTTAAAGG -3'

Posted On

2016-04-27