Incidental Mutation 'R4956:Obp2b'
ID381562
Institutional Source Beutler Lab
Gene Symbol Obp2b
Ensembl Gene ENSMUSG00000079539
Gene Nameodorant binding protein 2B
SynonymsLcn14, OTTMUSG00000012631
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4956 (G1)
Quality Score180
Status Validated
Chromosome2
Chromosomal Location25737009-25740097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25737075 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 7 (T7A)
Ref Sequence ENSEMBL: ENSMUSP00000109830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114192]
Predicted Effect probably damaging
Transcript: ENSMUST00000114192
AA Change: T7A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109830
Gene: ENSMUSG00000079539
AA Change: T7A

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Lipocalin 31 169 5.6e-32 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Obp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Obp2b APN 2 25738581 missense probably damaging 1.00
IGL01293:Obp2b APN 2 25737707 missense probably benign 0.00
IGL01731:Obp2b APN 2 25739281 missense possibly damaging 0.74
IGL01751:Obp2b APN 2 25737748 missense possibly damaging 0.89
IGL02631:Obp2b APN 2 25739243 missense probably damaging 0.96
R0035:Obp2b UTSW 2 25738633 missense probably damaging 1.00
R0035:Obp2b UTSW 2 25738633 missense probably damaging 1.00
R1753:Obp2b UTSW 2 25738640 critical splice donor site probably null
R1955:Obp2b UTSW 2 25738551 missense probably benign 0.12
R5253:Obp2b UTSW 2 25737143 missense probably benign 0.08
R6434:Obp2b UTSW 2 25738587 missense probably damaging 1.00
R7176:Obp2b UTSW 2 25737748 missense possibly damaging 0.89
Z1177:Obp2b UTSW 2 25737683 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AACAACCTTCAGCTCCATGATG -3'
(R):5'- ACCTGATCTGACCATTCCATGC -3'

Sequencing Primer
(F):5'- CCATGATGGATGTGTGTTTGGCC -3'
(R):5'- ATCTGACCATTCCATGCTGGGG -3'
Posted On2016-04-27