Incidental Mutation 'R0400:Fbp1'
ID38157
Institutional Source Beutler Lab
Gene Symbol Fbp1
Ensembl Gene ENSMUSG00000069805
Gene Namefructose bisphosphatase 1
SynonymsFbp-2, FBPase brain isoform, Fbp3, FBPase liver
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R0400 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location62864753-62888282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62865068 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 104 (T104S)
Ref Sequence ENSEMBL: ENSMUSP00000117146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092888] [ENSMUST00000150013]
Predicted Effect probably benign
Transcript: ENSMUST00000092888
AA Change: T309S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090564
Gene: ENSMUSG00000069805
AA Change: T309S

DomainStartEndE-ValueType
Pfam:FBPase 12 334 7.3e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150013
AA Change: T104S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117146
Gene: ENSMUSG00000069805
AA Change: T104S

DomainStartEndE-ValueType
Pfam:FBPase 1 71 5.3e-35 PFAM
Pfam:FBPase 70 130 2.7e-26 PFAM
Meta Mutation Damage Score 0.0859 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fructose-1,6-bisphosphatase 1, a gluconeogenesis regulatory enzyme, catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. Fructose-1,6-diphosphatase deficiency is associated with hypoglycemia and metabolic acidosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Fbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Fbp1 APN 13 62867379 missense probably damaging 0.99
IGL02224:Fbp1 APN 13 62888007 missense probably damaging 1.00
IGL02751:Fbp1 APN 13 62875143 splice site probably null
IGL02887:Fbp1 APN 13 62869080 missense probably benign
fruko UTSW 13 62875261 missense probably damaging 1.00
PIT4362001:Fbp1 UTSW 13 62867380 missense probably damaging 0.99
R0656:Fbp1 UTSW 13 62871285 missense probably benign 0.23
R1672:Fbp1 UTSW 13 62867431 missense probably damaging 0.98
R2420:Fbp1 UTSW 13 62871306 missense probably benign 0.00
R2422:Fbp1 UTSW 13 62871306 missense probably benign 0.00
R3859:Fbp1 UTSW 13 62865116 missense probably damaging 1.00
R4474:Fbp1 UTSW 13 62875261 missense probably damaging 1.00
R4990:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R4991:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R4992:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R5656:Fbp1 UTSW 13 62875196 missense probably damaging 0.97
R6463:Fbp1 UTSW 13 62865010 missense possibly damaging 0.52
R7381:Fbp1 UTSW 13 62865053 missense probably benign 0.01
R7448:Fbp1 UTSW 13 62872750 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGATAAAATGGACTCGACCCGGC -3'
(R):5'- AACCCTGATGGTGCAGCTTCTG -3'

Sequencing Primer
(F):5'- GTGAAACTATCCACGCTGTTAGG -3'
(R):5'- CAGCTTCTGGCTGAGGG -3'
Posted On2013-05-23