Incidental Mutation 'R4956:Zpr1'
ID381584
Institutional Source Beutler Lab
Gene Symbol Zpr1
Ensembl Gene ENSMUSG00000032078
Gene NameZPR1 zinc finger
SynonymsZfp259, ZPR1
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location46273064-46282643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46274663 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 144 (T144I)
Ref Sequence ENSEMBL: ENSMUSP00000117725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]
PDB Structure
Crystal structure of tandem ZPR1 domains [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034583
AA Change: T144I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034583
Gene: ENSMUSG00000032078
AA Change: T144I

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 387 1.56e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034584
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114552
AA Change: T86I
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078
AA Change: T86I

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121598
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143511
Predicted Effect probably damaging
Transcript: ENSMUST00000156440
AA Change: T144I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078
AA Change: T144I

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213878
Predicted Effect probably benign
Transcript: ENSMUST00000214202
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000215458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215484
Meta Mutation Damage Score 0.7353 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the cytoplasm of quiescent cells but translocates to the nucleolus in proliferating cells. The encoded protein interacts with survival motor neuron protein (SMN1) to enhance pre-mRNA splicing and to induce neuronal differentiation and axonal growth. Defects in this gene or the SMN1 gene can cause spinal muscular atrophy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to form a normal trophectoderm and fail to expand the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Other mutations in Zpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02960:Zpr1 APN 9 46273551 missense probably damaging 0.97
R0077:Zpr1 UTSW 9 46273336 missense probably damaging 1.00
R0081:Zpr1 UTSW 9 46279697 missense probably damaging 0.99
R0674:Zpr1 UTSW 9 46275449 missense probably damaging 1.00
R2419:Zpr1 UTSW 9 46276192 splice site probably benign
R4979:Zpr1 UTSW 9 46278342 missense probably benign 0.20
R5566:Zpr1 UTSW 9 46281075 missense possibly damaging 0.88
R6480:Zpr1 UTSW 9 46274711 missense probably benign 0.01
R6948:Zpr1 UTSW 9 46273641 critical splice donor site probably null
R7139:Zpr1 UTSW 9 46281059 missense probably damaging 1.00
R7366:Zpr1 UTSW 9 46273373 splice site probably null
R7996:Zpr1 UTSW 9 46273565 missense possibly damaging 0.95
R8169:Zpr1 UTSW 9 46278347 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TATTTTCTTTCAAAGCCTGGTCCAG -3'
(R):5'- TATCTGAAGTGCAGGAGGGC -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGACTAGGCTG -3'
(R):5'- AGGGCACACCGAGACGTG -3'
Posted On2016-04-27