Mutagenetix > Incidental Mutation

Incidental Mutation 'R4956:Zpr1'

381584

Institutional Source

Beutler Lab

Gene Symbol

Zpr1

Ensembl Gene

ENSMUSG00000032078

Gene Name

ZPR1 zinc finger

Synonyms

Zfp259, ZPR1

MMRRC Submission

042553-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4956 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46184362-46193941 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46185961 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 144 (T144I)

Ref Sequence

ENSEMBL: ENSMUSP00000117725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]

AlphaFold

Q62384

PDB Structure

Crystal structure of tandem ZPR1 domains [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034583
AA Change: T144I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034583
Gene: ENSMUSG00000032078
AA Change: T144I

Domain	Start	End	E-Value	Type
low complexity region	9	30	N/A	INTRINSIC
Zpr1	49	207	1.47e-93	SMART
low complexity region	236	246	N/A	INTRINSIC
Zpr1	257	387	1.56e-65	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000034584

SMART Domains

Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079

Domain	Start	End	E-Value	Type
Pfam:Apolipoprotein	52	264	5.1e-59	PFAM
Pfam:Apolipoprotein	258	315	1.8e-3	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000114552
AA Change: T86I

SMART Domains

Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078
AA Change: T86I

Domain	Start	End	E-Value	Type
Zpr1	12	150	5.57e-30	SMART
Zpr1	184	343	4.27e-90	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121598

SMART Domains

Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079

Domain	Start	End	E-Value	Type
Pfam:Apolipoprotein	51	305	8.1e-66	PFAM
low complexity region	312	323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125239

SMART Domains

Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
low complexity region	11	32	N/A	INTRINSIC
Blast:Zpr1	33	59	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141763

Predicted Effect

probably damaging
Transcript: ENSMUST00000156440
AA Change: T144I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078
AA Change: T144I

Domain	Start	End	E-Value	Type
low complexity region	9	30	N/A	INTRINSIC
Zpr1	49	207	1.47e-93	SMART
low complexity region	236	246	N/A	INTRINSIC
Zpr1	257	416	4.27e-90	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215484

Predicted Effect

probably benign
Transcript: ENSMUST00000213878

Predicted Effect

probably benign
Transcript: ENSMUST00000214202

Predicted Effect

probably benign
Transcript: ENSMUST00000215187

Predicted Effect

probably benign
Transcript: ENSMUST00000215458

Meta Mutation Damage Score

0.7353

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the cytoplasm of quiescent cells but translocates to the nucleolus in proliferating cells. The encoded protein interacts with survival motor neuron protein (SMN1) to enhance pre-mRNA splicing and to induce neuronal differentiation and axonal growth. Defects in this gene or the SMN1 gene can cause spinal muscular atrophy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to form a normal trophectoderm and fail to expand the inner cell mass. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,096,840 (GRCm39)		probably benign	Het
3110009E18Rik	C	T	1: 120,096,850 (GRCm39)		probably benign	Het
3110009E18Rik	G	T	1: 120,096,849 (GRCm39)		probably benign	Het
4930562C15Rik	A	G	16: 4,672,816 (GRCm39)	K866E	probably damaging	Het
Afap1l2	T	C	19: 56,931,879 (GRCm39)	M49V	probably benign	Het
Atf7ip	C	T	6: 136,583,808 (GRCm39)	R1280C	probably damaging	Het
Atp2a2	A	G	5: 122,599,643 (GRCm39)	F583L	probably benign	Het
Atxn7l3b	A	G	10: 112,764,501 (GRCm39)	C43R	probably damaging	Het
Axin2	T	C	11: 108,833,904 (GRCm39)	V617A	probably damaging	Het
Bltp3a	T	A	17: 28,108,958 (GRCm39)		probably null	Het
Brd1	A	T	15: 88,614,316 (GRCm39)	F193Y	probably damaging	Het
Cdc27	T	C	11: 104,420,221 (GRCm39)	S141G	probably damaging	Het
Chst9	A	T	18: 15,851,045 (GRCm39)	F7Y	probably damaging	Het
Cpn2	T	A	16: 30,079,233 (GRCm39)	Q156L	possibly damaging	Het
Dcaf6	A	T	1: 165,216,354 (GRCm39)	D416E	probably benign	Het
Dync1h1	C	A	12: 110,624,560 (GRCm39)	T3700N	probably damaging	Het
Eif2s3y	A	G	Y: 1,023,407 (GRCm39)	T430A	possibly damaging	Het
Enah	G	A	1: 181,745,854 (GRCm39)	T401I	probably damaging	Het
Esp38	T	G	17: 40,266,053 (GRCm39)	I54R	probably damaging	Het
Ffar4	C	T	19: 38,086,028 (GRCm39)	R152W	probably benign	Het
Flvcr1	A	G	1: 190,758,383 (GRCm39)		probably benign	Het
Fzd9	G	A	5: 135,278,796 (GRCm39)	A363V	probably damaging	Het
Gadl1	T	A	9: 115,869,987 (GRCm39)	I451N	probably benign	Het
Hmg20a	A	G	9: 56,388,948 (GRCm39)	T172A	probably damaging	Het
Ints1	G	A	5: 139,742,885 (GRCm39)	T1695M	probably damaging	Het
Ipo13	G	A	4: 117,758,768 (GRCm39)	A699V	probably benign	Het
Ipo9	A	G	1: 135,331,960 (GRCm39)		probably null	Het
Klra17	A	G	6: 129,850,279 (GRCm39)	L57P	probably damaging	Het
Map3k8	A	C	18: 4,339,530 (GRCm39)	D280E	probably benign	Het
Mycbp2	A	G	14: 103,524,675 (GRCm39)	F662L	probably damaging	Het
Ncor1	T	A	11: 62,231,431 (GRCm39)	H792L	probably damaging	Het
Nlrx1	T	A	9: 44,173,909 (GRCm39)	K431*	probably null	Het
Nos1	A	G	5: 118,085,575 (GRCm39)	N1301S	probably benign	Het
Obp2b	A	G	2: 25,627,087 (GRCm39)	T7A	probably damaging	Het
Odc1	T	C	12: 17,597,958 (GRCm39)	I95T	probably damaging	Het
Or2t43	A	G	11: 58,457,344 (GRCm39)	Y276H	probably damaging	Het
Or4c127	G	A	2: 89,833,187 (GRCm39)	V146M	probably benign	Het
Or5b97	C	T	19: 12,878,963 (GRCm39)	M60I	probably damaging	Het
Or6ae1	A	G	7: 139,741,993 (GRCm39)	I290T	possibly damaging	Het
Or6c1	A	T	10: 129,517,968 (GRCm39)	F213L	probably benign	Het
Pcif1	A	T	2: 164,731,610 (GRCm39)	Q521L	probably damaging	Het
Plekhg2	A	C	7: 28,067,780 (GRCm39)	L223R	probably damaging	Het
Plod3	A	G	5: 137,018,772 (GRCm39)	N270D	probably damaging	Het
Ppp1r37	A	T	7: 19,266,636 (GRCm39)	L417*	probably null	Het
Psmd6	C	T	14: 14,116,166 (GRCm38)	V141I	probably benign	Het
Rcn1	A	T	2: 105,225,121 (GRCm39)	Y111*	probably null	Het
Rell2	G	A	18: 38,090,758 (GRCm39)	R145H	probably damaging	Het
Scaper	T	C	9: 55,745,426 (GRCm39)	K614R	probably damaging	Het
Scart2	A	G	7: 139,878,275 (GRCm39)	I1001V	probably benign	Het
Shbg	C	T	11: 69,508,045 (GRCm39)	E107K	probably damaging	Het
Slc30a3	G	A	5: 31,244,247 (GRCm39)	P345L	possibly damaging	Het
Tchp	A	C	5: 114,857,681 (GRCm39)	E391D	probably damaging	Het
Timeless	A	G	10: 128,077,520 (GRCm39)	D200G	probably damaging	Het
Tspear	A	G	10: 77,700,601 (GRCm39)	T144A	possibly damaging	Het
Usp5	C	G	6: 124,799,593 (GRCm39)	K318N	possibly damaging	Het
Vgll3	T	C	16: 65,624,820 (GRCm39)	V56A	possibly damaging	Het
Vmn2r71	C	T	7: 85,268,436 (GRCm39)	T213I	probably benign	Het
Wtap	T	C	17: 13,186,423 (GRCm39)	T375A	probably benign	Het
Yipf2	T	G	9: 21,503,204 (GRCm39)	T88P	probably damaging	Het
Zfp382	T	A	7: 29,830,979 (GRCm39)	D89E	probably benign	Het
Zfp955b	C	T	17: 33,524,209 (GRCm39)		probably benign	Het

Other mutations in Zpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02960:Zpr1	APN	9	46,184,849 (GRCm39)	missense	probably damaging	0.97
R0077:Zpr1	UTSW	9	46,184,634 (GRCm39)	missense	probably damaging	1.00
R0081:Zpr1	UTSW	9	46,190,995 (GRCm39)	missense	probably damaging	0.99
R0674:Zpr1	UTSW	9	46,186,747 (GRCm39)	missense	probably damaging	1.00
R2419:Zpr1	UTSW	9	46,187,490 (GRCm39)	splice site	probably benign
R4979:Zpr1	UTSW	9	46,189,640 (GRCm39)	missense	probably benign	0.20
R5566:Zpr1	UTSW	9	46,192,373 (GRCm39)	missense	possibly damaging	0.88
R6480:Zpr1	UTSW	9	46,186,009 (GRCm39)	missense	probably benign	0.01
R6948:Zpr1	UTSW	9	46,184,939 (GRCm39)	critical splice donor site	probably null
R7139:Zpr1	UTSW	9	46,192,357 (GRCm39)	missense	probably damaging	1.00
R7366:Zpr1	UTSW	9	46,184,671 (GRCm39)	splice site	probably null
R7996:Zpr1	UTSW	9	46,184,863 (GRCm39)	missense	possibly damaging	0.95
R8169:Zpr1	UTSW	9	46,189,645 (GRCm39)	missense	possibly damaging	0.91
R8406:Zpr1	UTSW	9	46,185,400 (GRCm39)	missense	probably damaging	1.00
R8829:Zpr1	UTSW	9	46,192,344 (GRCm39)	nonsense	probably null
R9044:Zpr1	UTSW	9	46,190,995 (GRCm39)	missense	probably damaging	0.99
R9408:Zpr1	UTSW	9	46,186,747 (GRCm39)	missense	probably damaging	1.00
R9602:Zpr1	UTSW	9	46,184,663 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATTTTCTTTCAAAGCCTGGTCCAG -3'
(R):5'- TATCTGAAGTGCAGGAGGGC -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGACTAGGCTG -3'
(R):5'- AGGGCACACCGAGACGTG -3'

Posted On

2016-04-27