Incidental Mutation 'R0400:Nalcn'
ID 38159
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms Vgcnl1, A530023G15Rik
MMRRC Submission 038605-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0400 (G1)
Quality Score 218
Status Validated
Chromosome 14
Chromosomal Location 123514046-123864556 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 123528372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000201
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,376,360 (GRCm39) H169L probably benign Het
9130230L23Rik T C 5: 66,147,699 (GRCm39) D28G unknown Het
Abca12 T A 1: 71,298,935 (GRCm39) probably benign Het
Acsl5 T C 19: 55,282,143 (GRCm39) V573A probably damaging Het
Agap1 A G 1: 89,770,972 (GRCm39) probably benign Het
Arid2 A G 15: 96,254,806 (GRCm39) probably benign Het
B430305J03Rik T A 3: 61,271,556 (GRCm39) probably benign Het
Brsk2 T C 7: 141,552,290 (GRCm39) L584P probably damaging Het
C2cd4c A G 10: 79,449,043 (GRCm39) Y35H probably damaging Het
Cacul1 A G 19: 60,551,591 (GRCm39) probably benign Het
Cers3 T C 7: 66,414,078 (GRCm39) V88A probably benign Het
Cnnm1 A T 19: 43,456,803 (GRCm39) H614L probably damaging Het
Col1a1 T A 11: 94,832,195 (GRCm39) probably benign Het
Cyp1b1 T A 17: 80,021,016 (GRCm39) D242V probably damaging Het
Cyp4a31 T C 4: 115,420,915 (GRCm39) M1T probably null Het
Dbn1 C T 13: 55,622,729 (GRCm39) E585K probably damaging Het
Dclk2 A T 3: 86,721,054 (GRCm39) probably null Het
Dnah17 A G 11: 117,972,904 (GRCm39) S2010P probably damaging Het
Dram2 T C 3: 106,480,934 (GRCm39) L246P probably damaging Het
Dus2 A T 8: 106,775,309 (GRCm39) T279S probably benign Het
Epn2 T C 11: 61,423,522 (GRCm39) probably null Het
Esco2 C A 14: 66,069,155 (GRCm39) V52F possibly damaging Het
Fbp1 T A 13: 63,012,882 (GRCm39) T104S probably benign Het
Foxj2 A T 6: 122,810,767 (GRCm39) Q249L possibly damaging Het
Galnt7 T C 8: 58,037,023 (GRCm39) Y122C probably damaging Het
Gimd1 T C 3: 132,340,588 (GRCm39) Y35H probably benign Het
Gipc2 A G 3: 151,871,305 (GRCm39) F74L probably damaging Het
Glt1d1 T A 5: 127,734,139 (GRCm39) probably benign Het
Hmcn2 A G 2: 31,290,141 (GRCm39) T2325A probably damaging Het
Iffo1 A G 6: 125,130,434 (GRCm39) K471R probably damaging Het
Ireb2 G A 9: 54,803,782 (GRCm39) R491H probably benign Het
Isg20 A G 7: 78,566,473 (GRCm39) N141D possibly damaging Het
Kmt5c G A 7: 4,749,243 (GRCm39) R100H probably benign Het
Lrp1b T C 2: 40,640,926 (GRCm39) D3506G probably benign Het
Lrrn4 A C 2: 132,719,940 (GRCm39) F287V probably benign Het
Maco1 T C 4: 134,555,427 (GRCm39) K349E probably benign Het
Mmrn1 A C 6: 60,954,099 (GRCm39) K793N probably benign Het
Muc16 A G 9: 18,421,830 (GRCm39) V8227A possibly damaging Het
Myh2 C T 11: 67,083,424 (GRCm39) probably benign Het
Nfia T C 4: 97,951,373 (GRCm39) V400A probably damaging Het
Nxph4 T A 10: 127,362,127 (GRCm39) T255S possibly damaging Het
Olfm5 G A 7: 103,803,386 (GRCm39) T359I probably damaging Het
Or1e33 T C 11: 73,738,867 (GRCm39) Y28C probably benign Het
Or5t18 A G 2: 86,636,995 (GRCm39) M116T probably damaging Het
Or8b44 A G 9: 38,410,207 (GRCm39) M81V possibly damaging Het
Or8g21 G T 9: 38,906,494 (GRCm39) P79Q probably damaging Het
Pak5 T C 2: 135,939,499 (GRCm39) I545M possibly damaging Het
Pcdhb15 T C 18: 37,608,948 (GRCm39) F727L probably benign Het
Pds5b T A 5: 150,646,818 (GRCm39) N202K possibly damaging Het
Phlpp1 T A 1: 106,320,664 (GRCm39) I1553N probably benign Het
Pink1 T C 4: 138,045,229 (GRCm39) T282A probably damaging Het
Prdm2 A G 4: 142,838,240 (GRCm39) F1706S probably benign Het
Pycr1 G A 11: 120,532,352 (GRCm39) probably benign Het
Rigi A G 4: 40,235,257 (GRCm39) Y78H probably benign Het
Skint9 A G 4: 112,271,198 (GRCm39) S71P probably damaging Het
Smad1 A G 8: 80,098,399 (GRCm39) probably benign Het
Snapc5 A T 9: 64,087,789 (GRCm39) E33D probably damaging Het
Snrnp40 T C 4: 130,256,443 (GRCm39) L56P probably damaging Het
Stab2 A C 10: 86,708,474 (GRCm39) I1697S probably damaging Het
Tfap2a G T 13: 40,870,888 (GRCm39) probably benign Het
Tph2 A G 10: 114,916,025 (GRCm39) probably benign Het
Triml1 A G 8: 43,594,077 (GRCm39) V118A probably benign Het
Ttbk2 T A 2: 120,580,723 (GRCm39) T538S probably benign Het
Ttn A G 2: 76,545,616 (GRCm39) V32569A possibly damaging Het
U2af1 T A 17: 31,867,166 (GRCm39) Y158F probably benign Het
Usp7 A T 16: 8,534,496 (GRCm39) probably benign Het
Vdr A G 15: 97,767,232 (GRCm39) S179P probably benign Het
Vps13d A C 4: 144,792,397 (GRCm39) S663A probably benign Het
Wdr62 T A 7: 29,940,887 (GRCm39) T844S possibly damaging Het
Wipi1 C T 11: 109,467,956 (GRCm39) R407Q probably damaging Het
Zbtb43 A G 2: 33,343,909 (GRCm39) C439R probably damaging Het
Zfp507 T A 7: 35,491,171 (GRCm39) H704L probably damaging Het
Zzef1 G A 11: 72,786,068 (GRCm39) R2080K probably damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123,586,201 (GRCm39) missense probably benign 0.00
IGL00964:Nalcn APN 14 123,532,796 (GRCm39) splice site probably benign
IGL01310:Nalcn APN 14 123,554,661 (GRCm39) missense probably benign 0.00
IGL01578:Nalcn APN 14 123,809,503 (GRCm39) missense probably benign 0.00
IGL01925:Nalcn APN 14 123,529,260 (GRCm39) missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123,560,770 (GRCm39) missense probably benign 0.05
IGL02096:Nalcn APN 14 123,831,915 (GRCm39) missense probably benign 0.11
IGL02212:Nalcn APN 14 123,752,742 (GRCm39) missense probably damaging 0.99
IGL02306:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02471:Nalcn APN 14 123,560,726 (GRCm39) missense probably benign 0.02
IGL02478:Nalcn APN 14 123,558,717 (GRCm39) missense probably benign 0.26
IGL02551:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02630:Nalcn APN 14 123,555,291 (GRCm39) missense probably benign 0.16
IGL02632:Nalcn APN 14 123,555,265 (GRCm39) missense probably benign 0.11
IGL02661:Nalcn APN 14 123,830,321 (GRCm39) splice site probably benign
IGL02830:Nalcn APN 14 123,530,881 (GRCm39) missense probably damaging 0.98
IGL02939:Nalcn APN 14 123,536,284 (GRCm39) missense probably null 1.00
IGL03035:Nalcn APN 14 123,515,630 (GRCm39) nonsense probably null
IGL03226:Nalcn APN 14 123,518,527 (GRCm39) missense probably benign 0.00
IGL03242:Nalcn APN 14 123,558,899 (GRCm39) missense possibly damaging 0.91
Narnia UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0019:Nalcn UTSW 14 123,744,901 (GRCm39) missense probably benign 0.18
R0144:Nalcn UTSW 14 123,647,251 (GRCm39) splice site probably benign
R0144:Nalcn UTSW 14 123,608,948 (GRCm39) missense probably damaging 0.96
R0359:Nalcn UTSW 14 123,536,580 (GRCm39) missense probably damaging 1.00
R0383:Nalcn UTSW 14 123,744,971 (GRCm39) missense probably benign 0.01
R0467:Nalcn UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0506:Nalcn UTSW 14 123,834,026 (GRCm39) missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123,531,755 (GRCm39) missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123,536,553 (GRCm39) splice site probably benign
R0624:Nalcn UTSW 14 123,607,444 (GRCm39) missense probably benign
R0883:Nalcn UTSW 14 123,702,152 (GRCm39) missense probably damaging 1.00
R1381:Nalcn UTSW 14 123,551,517 (GRCm39) missense probably damaging 1.00
R1467:Nalcn UTSW 14 123,702,068 (GRCm39) splice site probably benign
R1689:Nalcn UTSW 14 123,522,666 (GRCm39) missense probably damaging 1.00
R1726:Nalcn UTSW 14 123,545,816 (GRCm39) missense probably damaging 1.00
R1774:Nalcn UTSW 14 123,515,678 (GRCm39) missense probably benign
R1854:Nalcn UTSW 14 123,697,824 (GRCm39) missense probably damaging 1.00
R1869:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123,521,013 (GRCm39) missense probably benign 0.00
R1899:Nalcn UTSW 14 123,553,538 (GRCm39) missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123,540,181 (GRCm39) missense probably benign 0.08
R2016:Nalcn UTSW 14 123,831,993 (GRCm39) splice site probably null
R2034:Nalcn UTSW 14 123,521,015 (GRCm39) missense probably benign 0.01
R2087:Nalcn UTSW 14 123,518,557 (GRCm39) missense probably benign
R2149:Nalcn UTSW 14 123,607,429 (GRCm39) missense probably benign 0.01
R2157:Nalcn UTSW 14 123,647,164 (GRCm39) missense probably benign 0.32
R2166:Nalcn UTSW 14 123,607,363 (GRCm39) missense probably benign 0.00
R2932:Nalcn UTSW 14 123,830,430 (GRCm39) missense probably benign 0.06
R3408:Nalcn UTSW 14 123,834,029 (GRCm39) missense probably null 0.98
R3778:Nalcn UTSW 14 123,702,128 (GRCm39) missense probably damaging 1.00
R3807:Nalcn UTSW 14 123,515,599 (GRCm39) missense probably damaging 1.00
R3835:Nalcn UTSW 14 123,530,834 (GRCm39) splice site probably benign
R3937:Nalcn UTSW 14 123,607,357 (GRCm39) missense probably benign 0.00
R4001:Nalcn UTSW 14 123,834,006 (GRCm39) missense probably damaging 1.00
R4015:Nalcn UTSW 14 123,723,799 (GRCm39) missense probably damaging 1.00
R4033:Nalcn UTSW 14 123,837,401 (GRCm39) splice site probably benign
R4231:Nalcn UTSW 14 123,837,325 (GRCm39) missense probably benign 0.01
R4464:Nalcn UTSW 14 123,560,762 (GRCm39) missense probably benign
R4512:Nalcn UTSW 14 123,532,860 (GRCm39) missense probably damaging 1.00
R4542:Nalcn UTSW 14 123,558,889 (GRCm39) synonymous silent
R4557:Nalcn UTSW 14 123,558,647 (GRCm39) intron probably benign
R4869:Nalcn UTSW 14 123,837,296 (GRCm39) missense probably benign 0.44
R5083:Nalcn UTSW 14 123,560,706 (GRCm39) splice site probably null
R5109:Nalcn UTSW 14 123,515,650 (GRCm39) missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123,753,182 (GRCm39) missense probably damaging 0.98
R5158:Nalcn UTSW 14 123,753,149 (GRCm39) missense probably damaging 1.00
R5259:Nalcn UTSW 14 123,753,063 (GRCm39) missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123,752,777 (GRCm39) missense probably damaging 1.00
R5514:Nalcn UTSW 14 123,521,123 (GRCm39) missense probably benign 0.14
R5523:Nalcn UTSW 14 123,647,155 (GRCm39) missense probably damaging 1.00
R5551:Nalcn UTSW 14 123,515,698 (GRCm39) missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5671:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5750:Nalcn UTSW 14 123,809,450 (GRCm39) missense probably benign
R5765:Nalcn UTSW 14 123,702,138 (GRCm39) missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123,647,161 (GRCm39) missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123,555,255 (GRCm39) missense probably benign 0.00
R6558:Nalcn UTSW 14 123,723,919 (GRCm39) missense probably benign
R6631:Nalcn UTSW 14 123,697,663 (GRCm39) missense probably benign 0.17
R6667:Nalcn UTSW 14 123,558,735 (GRCm39) missense probably damaging 1.00
R6670:Nalcn UTSW 14 123,702,084 (GRCm39) missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123,535,479 (GRCm39) missense probably damaging 0.99
R6731:Nalcn UTSW 14 123,837,346 (GRCm39) missense probably benign 0.22
R6957:Nalcn UTSW 14 123,744,966 (GRCm39) missense probably damaging 0.96
R6970:Nalcn UTSW 14 123,551,506 (GRCm39) missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123,530,877 (GRCm39) missense probably damaging 1.00
R7018:Nalcn UTSW 14 123,647,233 (GRCm39) missense probably damaging 1.00
R7040:Nalcn UTSW 14 123,525,267 (GRCm39) missense probably benign
R7089:Nalcn UTSW 14 123,515,761 (GRCm39) missense probably benign 0.01
R7128:Nalcn UTSW 14 123,831,914 (GRCm39) missense probably damaging 0.99
R7149:Nalcn UTSW 14 123,837,277 (GRCm39) missense probably benign 0.02
R7361:Nalcn UTSW 14 123,529,251 (GRCm39) missense probably benign 0.00
R7378:Nalcn UTSW 14 123,540,302 (GRCm39) missense probably damaging 1.00
R7408:Nalcn UTSW 14 123,529,272 (GRCm39) missense probably benign 0.00
R7470:Nalcn UTSW 14 123,809,456 (GRCm39) missense probably benign 0.09
R7483:Nalcn UTSW 14 123,551,499 (GRCm39) missense probably damaging 1.00
R7521:Nalcn UTSW 14 123,530,870 (GRCm39) missense probably damaging 1.00
R7558:Nalcn UTSW 14 123,723,797 (GRCm39) critical splice donor site probably null
R7585:Nalcn UTSW 14 123,753,050 (GRCm39) missense probably damaging 1.00
R7591:Nalcn UTSW 14 123,561,297 (GRCm39) missense probably benign 0.01
R7761:Nalcn UTSW 14 123,531,792 (GRCm39) missense probably damaging 1.00
R7761:Nalcn UTSW 14 123,531,791 (GRCm39) missense probably damaging 1.00
R7811:Nalcn UTSW 14 123,536,357 (GRCm39) missense probably damaging 1.00
R7983:Nalcn UTSW 14 123,830,409 (GRCm39) missense probably benign 0.17
R8089:Nalcn UTSW 14 123,537,372 (GRCm39) missense probably damaging 1.00
R8110:Nalcn UTSW 14 123,702,113 (GRCm39) missense probably benign 0.00
R8190:Nalcn UTSW 14 123,837,351 (GRCm39) missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123,554,436 (GRCm39) missense probably damaging 1.00
R8407:Nalcn UTSW 14 123,554,683 (GRCm39) missense probably damaging 1.00
R8497:Nalcn UTSW 14 123,752,771 (GRCm39) missense probably damaging 1.00
R8544:Nalcn UTSW 14 123,608,935 (GRCm39) missense probably benign 0.40
R8549:Nalcn UTSW 14 123,607,448 (GRCm39) missense probably benign 0.01
R8731:Nalcn UTSW 14 123,837,266 (GRCm39) missense probably benign 0.01
R8862:Nalcn UTSW 14 123,647,199 (GRCm39) missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123,561,284 (GRCm39) missense probably benign 0.00
R9072:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123,834,016 (GRCm39) missense probably damaging 1.00
R9193:Nalcn UTSW 14 123,545,792 (GRCm39) nonsense probably null
R9241:Nalcn UTSW 14 123,809,429 (GRCm39) missense probably benign 0.00
R9267:Nalcn UTSW 14 123,518,567 (GRCm39) missense probably benign 0.08
R9274:Nalcn UTSW 14 123,753,068 (GRCm39) missense probably damaging 1.00
R9277:Nalcn UTSW 14 123,518,523 (GRCm39) missense probably damaging 0.98
R9376:Nalcn UTSW 14 123,515,713 (GRCm39) missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123,522,653 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,831,980 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,531,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTGCAAAGCAACAGTGAC -3'
(R):5'- TGAGAGACATGCCAGCTTGGAAAC -3'

Sequencing Primer
(F):5'- gagattgagcaggtaaacaatgg -3'
(R):5'- GCTTGGAAACTGTACTAAAAGCAC -3'
Posted On 2013-05-23