Incidental Mutation 'R4956:Timeless'
ID381590
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128241651 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 200 (D200G)
Ref Sequence ENSEMBL: ENSMUSP00000100879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000125289]
Predicted Effect probably damaging
Transcript: ENSMUST00000055539
AA Change: D200G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: D200G

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105242
AA Change: D200G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: D200G

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105243
AA Change: D200G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994
AA Change: D200G

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105244
AA Change: D200G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: D200G

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105245
AA Change: D200G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: D200G

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125289
AA Change: D115G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132079
Gene: ENSMUSG00000039994
AA Change: D115G

DomainStartEndE-ValueType
Pfam:TIMELESS 1 123 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146945
Meta Mutation Damage Score 0.7481 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 intron probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1771:Timeless UTSW 10 128247608 missense probably benign 0.11
R1860:Timeless UTSW 10 128246114 missense probably benign 0.00
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R2981:Timeless UTSW 10 128248458 missense probably benign 0.34
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R5341:Timeless UTSW 10 128247178 missense possibly damaging 0.81
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R5843:Timeless UTSW 10 128244244 unclassified probably null
R6005:Timeless UTSW 10 128244200 missense probably damaging 0.99
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
R7345:Timeless UTSW 10 128249754 missense probably damaging 1.00
R7463:Timeless UTSW 10 128250426 missense probably benign 0.00
R7513:Timeless UTSW 10 128249530 missense probably damaging 0.99
R7574:Timeless UTSW 10 128244669 missense probably damaging 1.00
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTAGCCACAGAGTGAGCTG -3'
(R):5'- ATGGGCCTTGGATAGAACACAG -3'

Sequencing Primer
(F):5'- CACAGAGTGAGCTGCTGGG -3'
(R):5'- CCTTGGATAGAACACAGCCAGG -3'
Posted On2016-04-27