Incidental Mutation 'R4956:Olfr802'
ID381591
Institutional Source Beutler Lab
Gene Symbol Olfr802
Ensembl Gene ENSMUSG00000093866
Gene Nameolfactory receptor 802
SynonymsGA_x6K02T2PULF-11361362-11360424, MOR111-1
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129677683-129688169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129682099 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 213 (F213L)
Ref Sequence ENSEMBL: ENSMUSP00000150123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074713] [ENSMUST00000203785] [ENSMUST00000217576]
Predicted Effect probably benign
Transcript: ENSMUST00000074713
AA Change: F213L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074275
Gene: ENSMUSG00000093866
AA Change: F213L

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203785
AA Change: F213L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144741
Gene: ENSMUSG00000093866
AA Change: F213L

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217576
AA Change: F213L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1183 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Olfr802
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Olfr802 APN 10 129681988 nonsense probably null
IGL03112:Olfr802 APN 10 129681923 missense probably benign 0.08
R0366:Olfr802 UTSW 10 129681971 missense possibly damaging 0.72
R0463:Olfr802 UTSW 10 129681839 missense probably benign 0.11
R0579:Olfr802 UTSW 10 129682237 nonsense probably null
R1769:Olfr802 UTSW 10 129682212 missense probably benign 0.15
R2128:Olfr802 UTSW 10 129682532 missense possibly damaging 0.78
R2375:Olfr802 UTSW 10 129682163 missense probably benign 0.04
R3888:Olfr802 UTSW 10 129682218 missense possibly damaging 0.94
R3888:Olfr802 UTSW 10 129682219 missense probably benign 0.43
R5471:Olfr802 UTSW 10 129682056 missense probably damaging 1.00
R5588:Olfr802 UTSW 10 129681836 missense possibly damaging 0.72
R7305:Olfr802 UTSW 10 129682280 missense probably damaging 0.99
R7995:Olfr802 UTSW 10 129682640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCCTTGGTCAATGATGCTC -3'
(R):5'- TGCACAATGCTGGTCTTCGC -3'

Sequencing Primer
(F):5'- CAATGATGCTCTATCTGTAGCTGAG -3'
(R):5'- AATCATCTTCCCTGCACTGATG -3'
Posted On2016-04-27