Incidental Mutation 'R4956:Olfr224'
ID381592
Institutional Source Beutler Lab
Gene Symbol Olfr224
Ensembl Gene ENSMUSG00000059279
Gene Nameolfactory receptor 224
SynonymsGA_x6K02T2NKPP-858022-858862, Olfr327-ps1, MOR275-10_p, GA_x6K02T00261-652-347, MOR275-3
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58565856-58570553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58566518 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 276 (Y276H)
Ref Sequence ENSEMBL: ENSMUSP00000104450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081102] [ENSMUST00000108822] [ENSMUST00000215322] [ENSMUST00000216758] [ENSMUST00000217009]
Predicted Effect probably benign
Transcript: ENSMUST00000081102
AA Change: Y276H

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079881
Gene: ENSMUSG00000059279
AA Change: Y276H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.4e-35 PFAM
Pfam:7tm_4 137 281 5.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108822
AA Change: Y276H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104450
Gene: ENSMUSG00000064252
AA Change: Y276H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215322
AA Change: Y276H

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216758
AA Change: Y276H

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217009
AA Change: Y276H

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.3289 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Olfr224
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Olfr224 APN 11 58566767 missense probably damaging 1.00
IGL02327:Olfr224 APN 11 58566935 missense probably damaging 1.00
IGL02904:Olfr224 APN 11 58566797 missense possibly damaging 0.61
IGL02968:Olfr224 APN 11 58567195 missense possibly damaging 0.90
R1704:Olfr224 UTSW 11 58566754 missense probably damaging 0.97
R2055:Olfr224 UTSW 11 58566847 missense probably damaging 0.99
R3925:Olfr224 UTSW 11 58566826 missense probably benign 0.34
R4093:Olfr224 UTSW 11 58566829 missense probably damaging 1.00
R4902:Olfr224 UTSW 11 58566625 missense possibly damaging 0.60
R4955:Olfr224 UTSW 11 58566518 missense probably damaging 1.00
R4957:Olfr224 UTSW 11 58566518 missense probably damaging 1.00
R5436:Olfr224 UTSW 11 58566937 missense probably benign 0.34
R6699:Olfr224 UTSW 11 58567205 missense possibly damaging 0.69
R6825:Olfr224 UTSW 11 58566650 missense possibly damaging 0.89
R7467:Olfr224 UTSW 11 58566462 missense possibly damaging 0.82
R7590:Olfr224 UTSW 11 58567259 missense probably benign 0.09
R7600:Olfr224 UTSW 11 58567336 missense probably benign 0.17
R7725:Olfr224 UTSW 11 58566767 missense probably damaging 1.00
X0026:Olfr224 UTSW 11 58567174 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGCATGAGACCTGGAACAAC -3'
(R):5'- TGTGACAGTCATTTCAGGCTC -3'

Sequencing Primer
(F):5'- ATTTCTGAGTTCGAGGCCAGCC -3'
(R):5'- GTGACAGTCATTTCAGGCTCCTATTC -3'
Posted On2016-04-27