Incidental Mutation 'R4956:Axin2'
ID381596
Institutional Source Beutler Lab
Gene Symbol Axin2
Ensembl Gene ENSMUSG00000000142
Gene Nameaxin 2
SynonymsAxil, Conductin
MMRRC Submission 042553-MU
Accession Numbers

Genbank: NM_015732; MGI: 1270862

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location108920349-108950783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108943078 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 617 (V617A)
Ref Sequence ENSEMBL: ENSMUSP00000051331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052915] [ENSMUST00000106711]
Predicted Effect probably damaging
Transcript: ENSMUST00000052915
AA Change: V617A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051331
Gene: ENSMUSG00000000142
AA Change: V617A

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 9 73 8.1e-27 PFAM
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 472 7.6e-13 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 758 840 1.42e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106711
SMART Domains Protein: ENSMUSP00000102322
Gene: ENSMUSG00000000142

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 469 8.6e-22 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 693 775 1.42e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144130
Meta Mutation Damage Score 0.3205 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit premature fusion of cranial sutures, enhanced expansion of osteoprogenitors, accelerated ossification, and increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Axin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Axin2 APN 11 108923990 missense probably benign
IGL01094:Axin2 APN 11 108923675 missense probably damaging 0.99
IGL01563:Axin2 APN 11 108923805 missense probably damaging 0.97
IGL02088:Axin2 APN 11 108923616 missense probably damaging 1.00
IGL02724:Axin2 APN 11 108942946 missense possibly damaging 0.48
PIT4131001:Axin2 UTSW 11 108924003 missense possibly damaging 0.85
R0029:Axin2 UTSW 11 108924047 missense probably benign 0.01
R0052:Axin2 UTSW 11 108949270 missense probably damaging 1.00
R0112:Axin2 UTSW 11 108939397 missense possibly damaging 0.62
R0372:Axin2 UTSW 11 108923333 missense probably damaging 1.00
R0372:Axin2 UTSW 11 108924110 unclassified probably benign
R1200:Axin2 UTSW 11 108931550 missense probably damaging 0.98
R1924:Axin2 UTSW 11 108942968 missense probably benign 0.02
R2025:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R2427:Axin2 UTSW 11 108923974 missense possibly damaging 0.93
R4210:Axin2 UTSW 11 108942576 missense possibly damaging 0.89
R4781:Axin2 UTSW 11 108943856 missense probably damaging 1.00
R4846:Axin2 UTSW 11 108942299 missense probably benign 0.00
R7365:Axin2 UTSW 11 108939376 missense possibly damaging 0.93
R7519:Axin2 UTSW 11 108942246 missense probably benign 0.00
R7662:Axin2 UTSW 11 108942456 missense possibly damaging 0.96
R8103:Axin2 UTSW 11 108931543 missense probably damaging 0.99
X0054:Axin2 UTSW 11 108923574 missense probably damaging 1.00
Z1177:Axin2 UTSW 11 108923474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTGCCATGGAACTGTCC -3'
(R):5'- CCTCAGCCCAGTGTCTAATACTG -3'

Sequencing Primer
(F):5'- GACTGCCCAATTCCAGGAG -3'
(R):5'- CCCAGTGTCTAATACTGAGATGGC -3'
Posted On2016-04-27