Incidental Mutation 'R0400:Arid2'
ID38160
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene NameAT rich interactive domain 2 (ARID, RFX-like)
Synonyms4432409D24Rik, 1700124K17Rik, zipzap/p200
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0400 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96287518-96404992 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 96356925 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250] [ENSMUST00000134985]
Predicted Effect probably benign
Transcript: ENSMUST00000096250
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134985
SMART Domains Protein: ENSMUSP00000135829
Gene: ENSMUSG00000033237

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175735
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vdr A G 15: 97,869,351 S179P probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96372302 missense probably benign
IGL00321:Arid2 APN 15 96289089 missense probably damaging 0.97
IGL00434:Arid2 APN 15 96371300 missense probably damaging 0.99
IGL00576:Arid2 APN 15 96356758 missense probably damaging 0.99
IGL00766:Arid2 APN 15 96370405 missense probably benign 0.09
IGL01563:Arid2 APN 15 96372397 missense probably damaging 0.99
IGL01697:Arid2 APN 15 96361572 critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96356797 missense probably damaging 1.00
IGL02159:Arid2 APN 15 96358912 splice site probably benign
IGL02341:Arid2 APN 15 96372185 missense probably benign
IGL02416:Arid2 APN 15 96350055 missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96372235 missense probably benign 0.00
IGL02598:Arid2 APN 15 96371536 missense probably damaging 1.00
IGL02644:Arid2 APN 15 96368708 missense probably damaging 1.00
IGL02653:Arid2 APN 15 96287702 missense probably damaging 0.99
IGL03115:Arid2 APN 15 96370273 missense probably damaging 1.00
IGL03137:Arid2 APN 15 96371318 missense probably benign 0.44
IGL03220:Arid2 APN 15 96361772 missense probably damaging 0.99
IGL03249:Arid2 APN 15 96401965 missense probably damaging 1.00
IGL03256:Arid2 APN 15 96370762 missense probably benign 0.18
IGL03386:Arid2 APN 15 96361574 missense probably damaging 1.00
H8562:Arid2 UTSW 15 96369546 missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96369511 missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96370571 missense probably damaging 0.97
R0284:Arid2 UTSW 15 96378967 splice site probably benign
R0347:Arid2 UTSW 15 96370952 missense probably benign 0.01
R0366:Arid2 UTSW 15 96361720 splice site probably benign
R0650:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96369505 missense probably benign 0.01
R1615:Arid2 UTSW 15 96371654 missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96370183 missense probably benign 0.01
R2024:Arid2 UTSW 15 96361799 missense probably damaging 1.00
R2046:Arid2 UTSW 15 96369387 missense probably damaging 1.00
R2069:Arid2 UTSW 15 96362590 missense probably damaging 1.00
R2149:Arid2 UTSW 15 96370835 missense probably damaging 1.00
R2300:Arid2 UTSW 15 96402006 missense probably damaging 1.00
R2336:Arid2 UTSW 15 96362549 missense probably damaging 1.00
R2359:Arid2 UTSW 15 96361878 missense probably damaging 1.00
R2368:Arid2 UTSW 15 96350012 missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96369454 missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96361936 missense probably damaging 1.00
R3109:Arid2 UTSW 15 96356746 missense probably damaging 1.00
R3765:Arid2 UTSW 15 96370714 missense probably benign 0.01
R3785:Arid2 UTSW 15 96372558 missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3812:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3813:Arid2 UTSW 15 96369950 missense probably benign 0.26
R3843:Arid2 UTSW 15 96351840 missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96363622 missense probably damaging 1.00
R4279:Arid2 UTSW 15 96371756 missense probably damaging 1.00
R4569:Arid2 UTSW 15 96392462 missense probably damaging 1.00
R4597:Arid2 UTSW 15 96370856 missense probably damaging 1.00
R5020:Arid2 UTSW 15 96371988 missense probably damaging 0.96
R5154:Arid2 UTSW 15 96401985 missense probably damaging 1.00
R5303:Arid2 UTSW 15 96392468 missense probably damaging 1.00
R5620:Arid2 UTSW 15 96372506 missense probably benign 0.20
R5766:Arid2 UTSW 15 96372205 missense probably benign 0.01
R6005:Arid2 UTSW 15 96370972 missense probably benign
R6169:Arid2 UTSW 15 96368677 missense probably benign 0.36
R6216:Arid2 UTSW 15 96356909 missense probably benign 0.18
R6392:Arid2 UTSW 15 96361602 missense probably damaging 0.99
R6430:Arid2 UTSW 15 96363694 missense probably benign
R6454:Arid2 UTSW 15 96372413 missense probably benign 0.20
R6672:Arid2 UTSW 15 96362345 missense probably benign 0.30
R6776:Arid2 UTSW 15 96370949 missense probably benign 0.00
R6985:Arid2 UTSW 15 96370148 missense probably benign 0.06
R7132:Arid2 UTSW 15 96350013 missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96378875 missense probably damaging 0.99
R7453:Arid2 UTSW 15 96370724 missense probably benign
R7562:Arid2 UTSW 15 96401968 missense probably damaging 1.00
R7594:Arid2 UTSW 15 96390994 missense probably damaging 1.00
R7692:Arid2 UTSW 15 96356697 nonsense probably null
R7792:Arid2 UTSW 15 96369375 missense probably benign 0.05
R8036:Arid2 UTSW 15 96368744 missense probably damaging 1.00
R8094:Arid2 UTSW 15 96368711 missense possibly damaging 0.86
X0024:Arid2 UTSW 15 96372490 missense probably benign 0.00
X0066:Arid2 UTSW 15 96356804 missense probably damaging 1.00
Z1177:Arid2 UTSW 15 96390986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGAGTAGCCAGTCATCCTTCC -3'
(R):5'- CCCTCCTCACACAGTCAGAAGTAGTAG -3'

Sequencing Primer
(F):5'- CGATTAACTTACAACATGTGGTTTCG -3'
(R):5'- AGTCGATGGCAAATTCTCAAC -3'
Posted On2013-05-23