Incidental Mutation 'R0400:Vdr'
ID38161
Institutional Source Beutler Lab
Gene Symbol Vdr
Ensembl Gene ENSMUSG00000022479
Gene Namevitamin D (1,25-dihydroxyvitamin D3) receptor
SynonymsNr1i1
MMRRC Submission 038605-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0400 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97854425-97910630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97869351 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 179 (S179P)
Ref Sequence ENSEMBL: ENSMUSP00000023119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023119]
Predicted Effect probably benign
Transcript: ENSMUST00000023119
AA Change: S179P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479
AA Change: S179P

DomainStartEndE-ValueType
ZnF_C4 21 92 1.4e-34 SMART
low complexity region 102 114 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
HOLI 227 389 3.54e-36 SMART
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik T A 11: 30,426,360 H169L probably benign Het
9130230L23Rik T C 5: 65,990,356 D28G unknown Het
Abca12 T A 1: 71,259,776 probably benign Het
Acsl5 T C 19: 55,293,711 V573A probably damaging Het
Agap1 A G 1: 89,843,250 probably benign Het
Arid2 A G 15: 96,356,925 probably benign Het
B430305J03Rik T A 3: 61,364,135 probably benign Het
Brsk2 T C 7: 141,998,553 L584P probably damaging Het
C2cd4c A G 10: 79,613,209 Y35H probably damaging Het
Cacul1 A G 19: 60,563,153 probably benign Het
Cers3 T C 7: 66,764,330 V88A probably benign Het
Cnnm1 A T 19: 43,468,364 H614L probably damaging Het
Col1a1 T A 11: 94,941,369 probably benign Het
Cyp1b1 T A 17: 79,713,587 D242V probably damaging Het
Cyp4a31 T C 4: 115,563,718 M1T probably null Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dclk2 A T 3: 86,813,747 probably null Het
Ddx58 A G 4: 40,235,257 Y78H probably benign Het
Dnah17 A G 11: 118,082,078 S2010P probably damaging Het
Dram2 T C 3: 106,573,618 L246P probably damaging Het
Dus2 A T 8: 106,048,677 T279S probably benign Het
Epn2 T C 11: 61,532,696 probably null Het
Esco2 C A 14: 65,831,706 V52F possibly damaging Het
Fbp1 T A 13: 62,865,068 T104S probably benign Het
Foxj2 A T 6: 122,833,808 Q249L possibly damaging Het
Galnt7 T C 8: 57,583,989 Y122C probably damaging Het
Gimd1 T C 3: 132,634,827 Y35H probably benign Het
Gipc2 A G 3: 152,165,668 F74L probably damaging Het
Glt1d1 T A 5: 127,657,075 probably benign Het
Hmcn2 A G 2: 31,400,129 T2325A probably damaging Het
Iffo1 A G 6: 125,153,471 K471R probably damaging Het
Ireb2 G A 9: 54,896,498 R491H probably benign Het
Isg20 A G 7: 78,916,725 N141D possibly damaging Het
Kmt5c G A 7: 4,746,244 R100H probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrn4 A C 2: 132,878,020 F287V probably benign Het
Mmrn1 A C 6: 60,977,115 K793N probably benign Het
Muc16 A G 9: 18,510,534 V8227A possibly damaging Het
Myh2 C T 11: 67,192,598 probably benign Het
Nalcn T A 14: 123,290,960 probably benign Het
Nfia T C 4: 98,063,136 V400A probably damaging Het
Nxph4 T A 10: 127,526,258 T255S possibly damaging Het
Olfm5 G A 7: 104,154,179 T359I probably damaging Het
Olfr141 A G 2: 86,806,651 M116T probably damaging Het
Olfr393 T C 11: 73,848,041 Y28C probably benign Het
Olfr907 A G 9: 38,498,911 M81V possibly damaging Het
Olfr935 G T 9: 38,995,198 P79Q probably damaging Het
Pak7 T C 2: 136,097,579 I545M possibly damaging Het
Pcdhb15 T C 18: 37,475,895 F727L probably benign Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Phlpp1 T A 1: 106,392,934 I1553N probably benign Het
Pink1 T C 4: 138,317,918 T282A probably damaging Het
Prdm2 A G 4: 143,111,670 F1706S probably benign Het
Pycr1 G A 11: 120,641,526 probably benign Het
Skint9 A G 4: 112,414,001 S71P probably damaging Het
Smad1 A G 8: 79,371,770 probably benign Het
Snapc5 A T 9: 64,180,507 E33D probably damaging Het
Snrnp40 T C 4: 130,362,650 L56P probably damaging Het
Stab2 A C 10: 86,872,610 I1697S probably damaging Het
Tfap2a G T 13: 40,717,412 probably benign Het
Tmem57 T C 4: 134,828,116 K349E probably benign Het
Tph2 A G 10: 115,080,120 probably benign Het
Triml1 A G 8: 43,141,040 V118A probably benign Het
Ttbk2 T A 2: 120,750,242 T538S probably benign Het
Ttn A G 2: 76,715,272 V32569A possibly damaging Het
U2af1 T A 17: 31,648,192 Y158F probably benign Het
Usp7 A T 16: 8,716,632 probably benign Het
Vps13d A C 4: 145,065,827 S663A probably benign Het
Wdr62 T A 7: 30,241,462 T844S possibly damaging Het
Wipi1 C T 11: 109,577,130 R407Q probably damaging Het
Zbtb43 A G 2: 33,453,897 C439R probably damaging Het
Zfp507 T A 7: 35,791,746 H704L probably damaging Het
Zzef1 G A 11: 72,895,242 R2080K probably damaging Het
Other mutations in Vdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Vdr APN 15 97884854 missense probably damaging 1.00
IGL02813:Vdr APN 15 97869681 missense probably benign 0.45
yangshuo UTSW 15 97859121 missense probably damaging 1.00
R1102:Vdr UTSW 15 97859121 missense probably damaging 1.00
R1172:Vdr UTSW 15 97869333 missense probably benign 0.05
R1173:Vdr UTSW 15 97869333 missense probably benign 0.05
R1268:Vdr UTSW 15 97857475 missense probably benign 0.39
R1705:Vdr UTSW 15 97867171 missense probably damaging 1.00
R2879:Vdr UTSW 15 97859127 missense probably benign 0.01
R3030:Vdr UTSW 15 97857563 missense probably benign 0.00
R4695:Vdr UTSW 15 97858920 splice site probably null
R5074:Vdr UTSW 15 97857578 missense probably benign 0.35
R5710:Vdr UTSW 15 97859127 missense probably damaging 1.00
R5710:Vdr UTSW 15 97867208 missense probably benign 0.02
R5845:Vdr UTSW 15 97869766 missense possibly damaging 0.46
R5982:Vdr UTSW 15 97857596 missense probably benign 0.37
R6776:Vdr UTSW 15 97869828 missense probably damaging 1.00
R6865:Vdr UTSW 15 97857505 missense probably damaging 1.00
X0023:Vdr UTSW 15 97869818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGGCCCTTCCCACATCATAG -3'
(R):5'- AGAATCAGGTATAGCCCAGGCACG -3'

Sequencing Primer
(F):5'- ACCCCCTTTCTGTGAAAGAG -3'
(R):5'- ACCCAGGGAAGGTTCGG -3'
Posted On2013-05-23