Incidental Mutation 'R4957:Ccdc150'
ID381616
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
Synonyms4930511H11Rik
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4957 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 54364868 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect probably benign
Transcript: ENSMUST00000027128
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159682
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163072
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 intron probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54272497 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTTTAGCACCCTGGCAGTG -3'
(R):5'- TTCTGCAGGGTATTCATCTCAG -3'

Sequencing Primer
(F):5'- ACCCTGGCAGTGGCTGTG -3'
(R):5'- AATCTCTGGATGCTCAAGGAC -3'
Posted On2016-04-27