Incidental Mutation 'R4957:3110009E18Rik'
ID 381618
Institutional Source Beutler Lab
Gene Symbol 3110009E18Rik
Ensembl Gene ENSMUSG00000026388
Gene Name RIKEN cDNA 3110009E18 gene
Synonyms
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R4957 (G1)
Quality Score 133
Status Validated
Chromosome 1
Chromosomal Location 120121187-120188189 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to C at 120169110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027637] [ENSMUST00000056038] [ENSMUST00000112644]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027637
SMART Domains Protein: ENSMUSP00000027637
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056038
SMART Domains Protein: ENSMUSP00000053335
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112644
SMART Domains Protein: ENSMUSP00000108263
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 126 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128578
Predicted Effect unknown
Transcript: ENSMUST00000153037
AA Change: E79Q
SMART Domains Protein: ENSMUSP00000115887
Gene: ENSMUSG00000026388
AA Change: E79Q

DomainStartEndE-ValueType
Pfam:DUF2340 1 61 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187809
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in 3110009E18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:3110009E18Rik APN 1 120150606 unclassified probably benign
IGL00696:3110009E18Rik APN 1 120171426 missense probably damaging 0.98
IGL01482:3110009E18Rik APN 1 120171471 missense probably benign 0.16
IGL01996:3110009E18Rik APN 1 120150700 missense possibly damaging 0.94
R0033:3110009E18Rik UTSW 1 120188064 missense probably damaging 1.00
R0270:3110009E18Rik UTSW 1 120166176 splice site probably benign
R1025:3110009E18Rik UTSW 1 120171462 missense probably damaging 0.97
R1535:3110009E18Rik UTSW 1 120171473 missense possibly damaging 0.52
R4676:3110009E18Rik UTSW 1 120150652 missense probably damaging 1.00
R4955:3110009E18Rik UTSW 1 120169110 intron probably benign
R4955:3110009E18Rik UTSW 1 120169119 intron probably benign
R4955:3110009E18Rik UTSW 1 120169120 intron probably benign
R4956:3110009E18Rik UTSW 1 120169110 intron probably benign
R4956:3110009E18Rik UTSW 1 120169119 intron probably benign
R4956:3110009E18Rik UTSW 1 120169120 intron probably benign
R4957:3110009E18Rik UTSW 1 120169119 intron probably benign
R4957:3110009E18Rik UTSW 1 120169120 intron probably benign
R5866:3110009E18Rik UTSW 1 120169084 intron probably benign
R6151:3110009E18Rik UTSW 1 120171486 splice site probably null
R6229:3110009E18Rik UTSW 1 120171483 critical splice donor site probably null
R8187:3110009E18Rik UTSW 1 120188183 makesense probably null
R8498:3110009E18Rik UTSW 1 120169142 splice site probably null
R9049:3110009E18Rik UTSW 1 120188170 missense probably null
R9075:3110009E18Rik UTSW 1 120169284 missense
R9211:3110009E18Rik UTSW 1 120171431 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTCCAAATGGTAGGGAAGGC -3'
(R):5'- TGCTGTGCAAACAGAAACTGTC -3'

Sequencing Primer
(F):5'- AAGGCAAGGGATGGTTCTG -3'
(R):5'- GAAGGTGCCTATGACTTCAGTACC -3'
Posted On 2016-04-27