Incidental Mutation 'R4957:Cacnb4'
ID 381623
Institutional Source Beutler Lab
Gene Symbol Cacnb4
Ensembl Gene ENSMUSG00000017412
Gene Name calcium channel, voltage-dependent, beta 4 subunit
Synonyms Cchb4, 3110038O15Rik
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 52428320-52676831 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52558291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 8 (H8R)
Ref Sequence ENSEMBL: ENSMUSP00000099821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078324] [ENSMUST00000102760] [ENSMUST00000102761] [ENSMUST00000178799]
AlphaFold Q8R0S4
Predicted Effect probably benign
Transcript: ENSMUST00000078324
SMART Domains Protein: ENSMUSP00000077438
Gene: ENSMUSG00000017412

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 5.4e-27 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
low complexity region 193 206 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102760
AA Change: H8R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099821
Gene: ENSMUSG00000017412
AA Change: H8R

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 57 9.4e-28 PFAM
SH3 61 126 4.96e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
GuKc 184 365 3.46e-37 SMART
low complexity region 432 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102761
SMART Domains Protein: ENSMUSP00000099822
Gene: ENSMUSG00000017412

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 3 44 4.8e-27 PFAM
SH3 48 113 4.96e-2 SMART
low complexity region 126 143 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
GuKc 171 352 3.46e-37 SMART
low complexity region 419 435 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132322
Predicted Effect probably benign
Transcript: ENSMUST00000178799
SMART Domains Protein: ENSMUSP00000136811
Gene: ENSMUSG00000017412

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 1.3e-24 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants have lethargic behavior, unstable gait and seizures, with peripheral motor nerves showing reduced conduction velocity and prolonged distal latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Cacnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Cacnb4 APN 2 52477712 missense possibly damaging 0.46
IGL01328:Cacnb4 APN 2 52464625 missense probably damaging 1.00
IGL01801:Cacnb4 APN 2 52434711 missense probably benign 0.15
IGL01992:Cacnb4 APN 2 52465670 missense probably damaging 1.00
IGL03030:Cacnb4 APN 2 52474882 missense probably damaging 1.00
R0789:Cacnb4 UTSW 2 52451883 missense probably damaging 1.00
R1069:Cacnb4 UTSW 2 52455611 missense probably damaging 1.00
R1646:Cacnb4 UTSW 2 52474900 missense possibly damaging 0.87
R2050:Cacnb4 UTSW 2 52469586 missense probably damaging 0.99
R3939:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R3941:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R4455:Cacnb4 UTSW 2 52465653 missense probably damaging 1.00
R4497:Cacnb4 UTSW 2 52477771 missense probably damaging 1.00
R4707:Cacnb4 UTSW 2 52474915 missense probably benign 0.45
R4824:Cacnb4 UTSW 2 52675810 missense probably benign 0.00
R5913:Cacnb4 UTSW 2 52434784 intron probably benign
R6372:Cacnb4 UTSW 2 52434667 missense probably benign 0.00
R6945:Cacnb4 UTSW 2 52474954 missense probably damaging 1.00
R7557:Cacnb4 UTSW 2 52469567 missense probably damaging 1.00
R7821:Cacnb4 UTSW 2 52434508 missense possibly damaging 0.91
R8015:Cacnb4 UTSW 2 52464643 missense probably damaging 1.00
R8043:Cacnb4 UTSW 2 52465651 missense probably damaging 1.00
R8181:Cacnb4 UTSW 2 52474985 missense probably benign 0.00
R8376:Cacnb4 UTSW 2 52464653 nonsense probably null
R8466:Cacnb4 UTSW 2 52464667 missense probably damaging 1.00
R8765:Cacnb4 UTSW 2 52436989 missense probably damaging 0.99
R9018:Cacnb4 UTSW 2 52434694 missense probably benign 0.26
Z1176:Cacnb4 UTSW 2 52675812 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTTTGCTATCAAGTTAATTGCC -3'
(R):5'- TCTTGCCTGGTAAATCCACAGG -3'

Sequencing Primer
(F):5'- TTTCAGTTAGCTACACACTACACAG -3'
(R):5'- CTTGCCTGGTAAATCCACAGGAATTG -3'
Posted On 2016-04-27