Incidental Mutation 'R4957:Ncaph'
ID 381628
Institutional Source Beutler Lab
Gene Symbol Ncaph
Ensembl Gene ENSMUSG00000034906
Gene Name non-SMC condensin I complex, subunit H
Synonyms A730011O11Rik, HCAP-H, Brrn1
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 127103809-127133954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127121257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 352 (D352G)
Ref Sequence ENSEMBL: ENSMUSP00000106017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110387]
AlphaFold Q8C156
Predicted Effect possibly damaging
Transcript: ENSMUST00000110387
AA Change: D352G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106017
Gene: ENSMUSG00000034906
AA Change: D352G

DomainStartEndE-ValueType
Pfam:Cnd2 25 729 9e-160 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146142
Predicted Effect probably benign
Transcript: ENSMUST00000175885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177191
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the barr gene family and a regulatory subunit of the condensin complex. This complex is required for the conversion of interphase chromatin into condensed chromosomes. The protein encoded by this gene is associated with mitotic chromosomes, except during the early phase of chromosome condensation. During interphase, the protein has a distinct punctate nucleolar localization. Alternatively spliced transcript variants encoding different proteins have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice die before E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Ncaph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Ncaph APN 2 127126105 splice site probably benign
IGL02619:Ncaph APN 2 127127536 missense probably damaging 0.99
IGL02674:Ncaph APN 2 127113576 missense probably damaging 0.98
IGL02679:Ncaph APN 2 127124864 missense possibly damaging 0.95
R2060:Ncaph UTSW 2 127124875 missense probably damaging 1.00
R3508:Ncaph UTSW 2 127127193 missense probably benign 0.33
R4283:Ncaph UTSW 2 127121085 intron probably benign
R4761:Ncaph UTSW 2 127106116 missense probably benign 0.07
R5491:Ncaph UTSW 2 127123675 missense probably benign
R5942:Ncaph UTSW 2 127116688 splice site probably null
R6523:Ncaph UTSW 2 127105889 missense probably damaging 0.97
R7177:Ncaph UTSW 2 127116586 missense probably damaging 1.00
R7188:Ncaph UTSW 2 127122114 missense probably benign 0.09
R7467:Ncaph UTSW 2 127133875 unclassified probably benign
R7857:Ncaph UTSW 2 127104245 missense probably damaging 0.99
R8699:Ncaph UTSW 2 127121176 missense possibly damaging 0.83
R8701:Ncaph UTSW 2 127106138 missense probably benign 0.13
R8843:Ncaph UTSW 2 127108609 missense probably benign
R9090:Ncaph UTSW 2 127116634 missense probably damaging 0.99
R9271:Ncaph UTSW 2 127116634 missense probably damaging 0.99
X0021:Ncaph UTSW 2 127127138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTATTTAGAAACCTTCTGGG -3'
(R):5'- GCAACCTGCACTGCACAATG -3'

Sequencing Primer
(F):5'- ATTTAGAAACCTTCTGGGACCCCG -3'
(R):5'- ATGTAAACTTCCTCCTGACAGCG -3'
Posted On 2016-04-27