Mutagenetix > Incidental Mutation

Incidental Mutation 'R4957:Mme'

381631

Institutional Source

Beutler Lab

Gene Symbol

Mme

Ensembl Gene

ENSMUSG00000027820

Gene Name

membrane metallo endopeptidase

Synonyms

CD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik

MMRRC Submission

042554-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4957 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63241537-63386030 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 63343489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]

AlphaFold

Q61391

Predicted Effect

probably benign
Transcript: ENSMUST00000029400

SMART Domains

Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.7e-103	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	5.8e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193805

Predicted Effect

probably benign
Transcript: ENSMUST00000194134

SMART Domains

Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.4e-134	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	3.3e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000194150

SMART Domains

Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820

Domain	Start	End	E-Value	Type
PDB:2YVC\|F	2	23	5e-7	PDB
transmembrane domain	29	51	N/A	INTRINSIC
Pfam:Peptidase_M13_N	80	483	8.4e-134	PFAM
low complexity region	489	507	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
Pfam:Peptidase_M13	543	749	3.3e-67	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Arhgap33	C	T	7: 30,532,361	G101R	probably damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Clptm1l	T	A	13: 73,611,196	I245N	possibly damaging	Het
Clptm1l	T	C	13: 73,612,428	I310T	probably damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Crebbp	T	C	16: 4,117,367	Q460R	probably benign	Het
Dnah17	A	T	11: 118,074,298	I2306N	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Ybx1	A	T	4: 119,278,938		probably benign	Het
Zfp39	T	A	11: 58,891,231	Y235F	possibly damaging	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Mme

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Mme	APN	3	63340044	missense	possibly damaging	0.95
IGL00329:Mme	APN	3	63380328	nonsense	probably null
IGL01013:Mme	APN	3	63327860	splice site	probably null
IGL01316:Mme	APN	3	63340159	splice site	probably benign
IGL01333:Mme	APN	3	63346091	missense	probably damaging	1.00
IGL01392:Mme	APN	3	63362046	missense	probably damaging	1.00
IGL01566:Mme	APN	3	63361929	splice site	probably benign
IGL01739:Mme	APN	3	63340113	missense	possibly damaging	0.78
IGL01996:Mme	APN	3	63343549	missense	probably benign	0.11
IGL02125:Mme	APN	3	63348649	missense	probably damaging	1.00
IGL02154:Mme	APN	3	63343555	missense	probably benign
IGL03214:Mme	APN	3	63329690	missense	possibly damaging	0.72
IGL03291:Mme	APN	3	63346104	missense	probably benign	0.00
R0498:Mme	UTSW	3	63346066	missense	probably damaging	1.00
R0595:Mme	UTSW	3	63328181	missense	probably benign	0.27
R0980:Mme	UTSW	3	63340129	missense	probably benign
R1210:Mme	UTSW	3	63343606	missense	probably benign	0.01
R1600:Mme	UTSW	3	63365058	missense	probably damaging	1.00
R1852:Mme	UTSW	3	63327983	missense	probably benign	0.31
R1852:Mme	UTSW	3	63328046	missense	probably benign	0.00
R2037:Mme	UTSW	3	63328260	missense	probably null	1.00
R2177:Mme	UTSW	3	63301005	missense	probably benign	0.02
R2200:Mme	UTSW	3	63380292	missense	possibly damaging	0.87
R2306:Mme	UTSW	3	63300252	missense	probably benign	0.00
R2847:Mme	UTSW	3	63345199	missense	possibly damaging	0.91
R3008:Mme	UTSW	3	63358957	missense	probably damaging	1.00
R3749:Mme	UTSW	3	63343540	missense	probably damaging	1.00
R3876:Mme	UTSW	3	63362059	splice site	probably benign
R3961:Mme	UTSW	3	63345192	missense	probably damaging	1.00
R3981:Mme	UTSW	3	63328064	missense	probably damaging	1.00
R3982:Mme	UTSW	3	63328064	missense	probably damaging	1.00
R3983:Mme	UTSW	3	63328064	missense	probably damaging	1.00
R4494:Mme	UTSW	3	63347192	missense	probably benign
R4589:Mme	UTSW	3	63380272	missense	probably benign
R4706:Mme	UTSW	3	63348712	missense	possibly damaging	0.92
R4871:Mme	UTSW	3	63340032	missense	probably benign	0.01
R5053:Mme	UTSW	3	63364849	missense	probably damaging	1.00
R5316:Mme	UTSW	3	63368954	missense	probably damaging	1.00
R5502:Mme	UTSW	3	63300281	nonsense	probably null
R5579:Mme	UTSW	3	63348645	missense	probably damaging	1.00
R6007:Mme	UTSW	3	63343508	nonsense	probably null
R6022:Mme	UTSW	3	63364797	missense	probably damaging	1.00
R6143:Mme	UTSW	3	63300111	splice site	probably null
R6154:Mme	UTSW	3	63300253	missense	probably damaging	0.98
R6333:Mme	UTSW	3	63341961	missense	probably benign	0.00
R6476:Mme	UTSW	3	63343635	critical splice donor site	probably null
R6514:Mme	UTSW	3	63364844	nonsense	probably null
R6711:Mme	UTSW	3	63341918	missense	possibly damaging	0.93
R6842:Mme	UTSW	3	63362044	missense	probably damaging	1.00
R6996:Mme	UTSW	3	63346102	missense	possibly damaging	0.63
R7040:Mme	UTSW	3	63368923	missense	probably damaging	1.00
R7043:Mme	UTSW	3	63345217	nonsense	probably null
R7084:Mme	UTSW	3	63328217	missense	probably damaging	0.98
R7126:Mme	UTSW	3	63368901	missense	probably damaging	0.97
R7783:Mme	UTSW	3	63364867	missense	probably damaging	1.00
R8501:Mme	UTSW	3	63326735	missense	probably damaging	1.00
R8857:Mme	UTSW	3	63348649	missense	probably damaging	1.00
R9453:Mme	UTSW	3	63364885	missense	possibly damaging	0.90
X0058:Mme	UTSW	3	63365021	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGTGTACTCTGTATACACAACAG -3'
(R):5'- AAGATATGGGCTTTCTGACATACC -3'

Sequencing Primer
(F):5'- TCATGTTGCAGAGATAATAGCTATTC -3'
(R):5'- TCTGACATACCTACCTGGGAG -3'

Posted On

2016-04-27