Incidental Mutation 'R4957:Frrs1'
ID 381632
Institutional Source Beutler Lab
Gene Symbol Frrs1
Ensembl Gene ENSMUSG00000033386
Gene Name ferric-chelate reductase 1
Synonyms Sdfr2
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 116859464-116908177 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 116885248 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 240 (D240N)
Ref Sequence ENSEMBL: ENSMUSP00000143255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040260] [ENSMUST00000195905] [ENSMUST00000199626]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040260
AA Change: D240N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039487
Gene: ENSMUSG00000033386
AA Change: D240N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 32 155 1.1e-34 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195905
AA Change: D240N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143255
Gene: ENSMUSG00000033386
AA Change: D240N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 31 156 4.6e-40 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199626
SMART Domains Protein: ENSMUSP00000143546
Gene: ENSMUSG00000033386

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the cytochrome b561 (CYB561; MIM 600019) family, including FRRS1, reduce ferric to ferrous iron before its transport from the endosome to the cytoplasm (Vargas et al., 2003 [PubMed 14499595]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Frrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Frrs1 APN 3 116902400 missense probably damaging 1.00
IGL00792:Frrs1 APN 3 116885295 splice site probably null
IGL01395:Frrs1 APN 3 116901005 missense probably benign 0.02
IGL01504:Frrs1 APN 3 116900658 missense probably damaging 1.00
IGL01548:Frrs1 APN 3 116885185 missense probably damaging 1.00
IGL01924:Frrs1 APN 3 116885239 missense probably damaging 1.00
IGL03037:Frrs1 APN 3 116902467 unclassified probably benign
IGL03104:Frrs1 APN 3 116881782 missense probably benign 0.00
IGL03143:Frrs1 APN 3 116899187 missense probably damaging 0.99
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0107:Frrs1 UTSW 3 116896716 missense probably damaging 0.97
R0138:Frrs1 UTSW 3 116881807 missense possibly damaging 0.65
R0532:Frrs1 UTSW 3 116883164 missense probably benign
R0646:Frrs1 UTSW 3 116902421 missense possibly damaging 0.50
R1534:Frrs1 UTSW 3 116878408 missense probably benign 0.14
R1596:Frrs1 UTSW 3 116883199 intron probably benign
R1880:Frrs1 UTSW 3 116896795 critical splice donor site probably null
R2193:Frrs1 UTSW 3 116878345 missense probably damaging 1.00
R2851:Frrs1 UTSW 3 116885129 missense probably benign 0.00
R3177:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3277:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3772:Frrs1 UTSW 3 116878387 missense possibly damaging 0.71
R4457:Frrs1 UTSW 3 116896728 missense probably benign 0.10
R4887:Frrs1 UTSW 3 116902416 makesense probably null
R5015:Frrs1 UTSW 3 116878439 missense probably damaging 1.00
R5080:Frrs1 UTSW 3 116902936 missense probably benign 0.02
R5256:Frrs1 UTSW 3 116903100 missense possibly damaging 0.88
R5280:Frrs1 UTSW 3 116880896 missense probably benign 0.00
R5597:Frrs1 UTSW 3 116878238 start gained probably benign
R5887:Frrs1 UTSW 3 116896750 missense probably benign 0.32
R6210:Frrs1 UTSW 3 116878431 missense probably benign 0.19
R6268:Frrs1 UTSW 3 116903099 missense probably damaging 0.98
R6378:Frrs1 UTSW 3 116900990 missense possibly damaging 0.95
R7165:Frrs1 UTSW 3 116878271 missense probably benign 0.18
R7220:Frrs1 UTSW 3 116880776 nonsense probably null
R7301:Frrs1 UTSW 3 116895563 missense possibly damaging 0.47
R7312:Frrs1 UTSW 3 116881777 missense probably damaging 1.00
R7862:Frrs1 UTSW 3 116891880 missense possibly damaging 0.83
R8032:Frrs1 UTSW 3 116878360 missense probably benign 0.00
R8114:Frrs1 UTSW 3 116881776 missense probably damaging 0.97
R8283:Frrs1 UTSW 3 116878303 missense probably benign 0.01
R8353:Frrs1 UTSW 3 116899173 missense possibly damaging 0.81
R8923:Frrs1 UTSW 3 116902421 missense possibly damaging 0.50
R9302:Frrs1 UTSW 3 116899250 critical splice donor site probably null
R9336:Frrs1 UTSW 3 116890933 missense probably benign
R9455:Frrs1 UTSW 3 116902323 missense possibly damaging 0.93
X0063:Frrs1 UTSW 3 116902422 missense possibly damaging 0.67
Z1177:Frrs1 UTSW 3 116881818 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTGGCAGTAAACTACTTGCTTC -3'
(R):5'- CTGCCCTATTACCGACATCATG -3'

Sequencing Primer
(F):5'- GCTTCATAGTTAAGACCTTCATCC -3'
(R):5'- GCCATTAAAATGACTCTGTTCTTAGG -3'
Posted On 2016-04-27