Incidental Mutation 'R4957:Tnc'
ID 381635
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Name tenascin C
Synonyms TN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission 042554-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 63959785-64047015 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 63976556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 1531 (P1531R)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]
AlphaFold Q80YX1
Predicted Effect probably damaging
Transcript: ENSMUST00000030056
AA Change: P1531R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: P1531R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: P1622R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: P1622R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107377
AA Change: P1531R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: P1531R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Meta Mutation Damage Score 0.9428 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 (GRCm38) probably benign Het
3110009E18Rik G T 1: 120,169,119 (GRCm38) probably benign Het
3110009E18Rik C T 1: 120,169,120 (GRCm38) probably benign Het
6820408C15Rik T A 2: 152,444,093 (GRCm38) V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 (GRCm38) G101R probably damaging Het
Atf7ip C T 6: 136,606,810 (GRCm38) R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 (GRCm38) H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 (GRCm38) probably benign Het
Cd74 A G 18: 60,809,037 (GRCm38) N113D probably benign Het
Cdc25b T C 2: 131,193,605 (GRCm38) V341A possibly damaging Het
Clptm1l T C 13: 73,612,428 (GRCm38) I310T probably damaging Het
Clptm1l T A 13: 73,611,196 (GRCm38) I245N possibly damaging Het
Creb5 A T 6: 53,693,922 (GRCm38) probably null Het
Crebbp T C 16: 4,117,367 (GRCm38) Q460R probably benign Het
Dnah17 A T 11: 118,074,298 (GRCm38) I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 (GRCm38) T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 (GRCm38) H215L probably damaging Het
Enkd1 A G 8: 105,704,489 (GRCm38) I202T probably benign Het
Epha7 C T 4: 28,871,892 (GRCm38) A407V probably damaging Het
Ercc3 G T 18: 32,243,117 (GRCm38) G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 (GRCm38) E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 (GRCm38) N339K probably damaging Het
Frrs1 G A 3: 116,885,248 (GRCm38) D240N probably benign Het
Gemin2 A G 12: 59,017,168 (GRCm38) S105G probably benign Het
Glra1 T A 11: 55,527,398 (GRCm38) I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 (GRCm38) P354S probably damaging Het
Gpr15 G T 16: 58,718,174 (GRCm38) A184E probably damaging Het
Grm7 G A 6: 111,358,863 (GRCm38) G745E probably damaging Het
H2-T10 T A 17: 36,117,416 (GRCm38) probably benign Het
Hdac5 C A 11: 102,205,256 (GRCm38) probably benign Het
Ift22 G A 5: 136,908,216 (GRCm38) probably benign Het
Ighg3 T C 12: 113,361,130 (GRCm38) E34G unknown Het
Itga11 A T 9: 62,767,648 (GRCm38) T821S probably benign Het
Lmod2 T C 6: 24,603,872 (GRCm38) V282A possibly damaging Het
Maml2 A G 9: 13,620,276 (GRCm38) K262R probably damaging Het
Mme T A 3: 63,343,489 (GRCm38) probably benign Het
Mnat1 A G 12: 73,123,878 (GRCm38) Y14C probably damaging Het
Mtdh A T 15: 34,083,135 (GRCm38) T34S possibly damaging Het
Ncaph T C 2: 127,121,257 (GRCm38) D352G possibly damaging Het
Or2t43 A G 11: 58,566,518 (GRCm38) Y276H probably damaging Het
Or4f17-ps1 C A 2: 111,528,224 (GRCm38) N321K probably benign Het
Or5m9b T A 2: 86,075,510 (GRCm38) Y257N probably damaging Het
Or9g8 T C 2: 85,777,115 (GRCm38) F177S probably damaging Het
Pcdhb13 T A 18: 37,444,784 (GRCm38) D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 (GRCm38) R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 (GRCm38) L409F possibly damaging Het
Prlr G T 15: 10,319,195 (GRCm38) C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 (GRCm38) T772I probably benign Het
Ryr2 T C 13: 11,785,080 (GRCm38) Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 (GRCm38) E634G probably benign Het
Scart1 T C 7: 140,228,522 (GRCm38) V782A probably damaging Het
Skic3 T G 13: 76,185,113 (GRCm38) probably null Het
Slc39a14 A T 14: 70,315,811 (GRCm38) S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 (GRCm38) T176S probably benign Het
Srsf10 T C 4: 135,856,230 (GRCm38) S2P probably damaging Het
Tcam1 T A 11: 106,282,879 (GRCm38) C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 (GRCm38) probably null Het
Tdrd3 T A 14: 87,505,787 (GRCm38) H390Q probably benign Het
Tlk2 T C 11: 105,253,359 (GRCm38) probably null Het
Tnfrsf1b C A 4: 145,246,757 (GRCm38) Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 (GRCm38) Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 (GRCm38) E264V probably damaging Het
Ugt3a2 G A 15: 9,365,188 (GRCm38) V296I probably benign Het
Usp5 C G 6: 124,822,630 (GRCm38) K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 (GRCm38) E541A probably benign Het
Ybx1 A T 4: 119,278,938 (GRCm38) probably benign Het
Zfp39 T A 11: 58,891,231 (GRCm38) Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 (GRCm38) K32* probably null Het
Zpbp2 T A 11: 98,551,324 (GRCm38) probably null Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64,016,824 (GRCm38) splice site probably benign
IGL00531:Tnc APN 4 63,971,153 (GRCm38) splice site probably benign
IGL00674:Tnc APN 4 63,965,607 (GRCm38) missense probably damaging 1.00
IGL01015:Tnc APN 4 64,017,334 (GRCm38) missense probably benign 0.19
IGL01090:Tnc APN 4 64,000,080 (GRCm38) missense probably damaging 1.00
IGL01310:Tnc APN 4 64,013,077 (GRCm38) missense probably benign 0.03
IGL01331:Tnc APN 4 63,982,875 (GRCm38) missense probably damaging 0.99
IGL01393:Tnc APN 4 64,014,054 (GRCm38) splice site probably benign
IGL01411:Tnc APN 4 64,000,722 (GRCm38) missense probably damaging 0.96
IGL01472:Tnc APN 4 64,006,419 (GRCm38) missense probably benign 0.00
IGL01552:Tnc APN 4 63,970,408 (GRCm38) missense probably damaging 1.00
IGL01661:Tnc APN 4 63,970,307 (GRCm38) splice site probably benign
IGL01669:Tnc APN 4 64,000,701 (GRCm38) missense probably damaging 1.00
IGL01912:Tnc APN 4 64,008,740 (GRCm38) missense probably damaging 1.00
IGL02028:Tnc APN 4 63,966,672 (GRCm38) splice site probably benign
IGL02100:Tnc APN 4 64,000,161 (GRCm38) missense possibly damaging 0.84
IGL02549:Tnc APN 4 64,015,072 (GRCm38) missense probably damaging 1.00
IGL02642:Tnc APN 4 63,965,579 (GRCm38) splice site probably benign
IGL02712:Tnc APN 4 63,975,256 (GRCm38) missense probably damaging 1.00
IGL02876:Tnc APN 4 64,015,101 (GRCm38) missense possibly damaging 0.56
IGL02886:Tnc APN 4 64,000,107 (GRCm38) missense probably damaging 0.96
IGL02972:Tnc APN 4 63,976,478 (GRCm38) missense probably benign 0.11
IGL03073:Tnc APN 4 63,971,224 (GRCm38) missense possibly damaging 0.58
IGL03116:Tnc APN 4 64,014,033 (GRCm38) missense probably damaging 1.00
IGL03181:Tnc APN 4 63,967,306 (GRCm38) missense possibly damaging 0.95
IGL03358:Tnc APN 4 64,017,615 (GRCm38) nonsense probably null
tancredo UTSW 4 63,993,297 (GRCm38) nonsense probably null
BB009:Tnc UTSW 4 64,008,620 (GRCm38) missense probably benign
BB019:Tnc UTSW 4 64,008,620 (GRCm38) missense probably benign
P0020:Tnc UTSW 4 64,008,857 (GRCm38) missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64,017,736 (GRCm38) missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63,964,667 (GRCm38) missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63,964,667 (GRCm38) missense probably damaging 1.00
R0243:Tnc UTSW 4 63,970,420 (GRCm38) missense probably damaging 0.98
R0362:Tnc UTSW 4 64,017,442 (GRCm38) missense probably damaging 1.00
R0410:Tnc UTSW 4 64,007,694 (GRCm38) missense probably benign 0.00
R0420:Tnc UTSW 4 64,000,159 (GRCm38) missense probably benign 0.00
R0540:Tnc UTSW 4 64,020,455 (GRCm38) missense probably damaging 1.00
R0650:Tnc UTSW 4 64,008,734 (GRCm38) missense probably benign 0.00
R1019:Tnc UTSW 4 63,962,082 (GRCm38) missense probably damaging 1.00
R1102:Tnc UTSW 4 64,020,468 (GRCm38) missense probably benign 0.05
R1126:Tnc UTSW 4 64,018,120 (GRCm38) missense probably damaging 0.99
R1141:Tnc UTSW 4 64,013,994 (GRCm38) missense probably damaging 1.00
R1142:Tnc UTSW 4 64,013,994 (GRCm38) missense probably damaging 1.00
R1307:Tnc UTSW 4 64,008,859 (GRCm38) missense probably damaging 0.98
R1322:Tnc UTSW 4 64,013,994 (GRCm38) missense probably damaging 1.00
R1414:Tnc UTSW 4 63,965,695 (GRCm38) splice site probably benign
R1470:Tnc UTSW 4 63,966,574 (GRCm38) missense probably damaging 1.00
R1470:Tnc UTSW 4 63,966,574 (GRCm38) missense probably damaging 1.00
R1499:Tnc UTSW 4 63,964,754 (GRCm38) missense probably benign 0.15
R1506:Tnc UTSW 4 64,007,684 (GRCm38) missense possibly damaging 0.90
R1597:Tnc UTSW 4 64,006,384 (GRCm38) missense probably benign
R1750:Tnc UTSW 4 63,972,735 (GRCm38) missense probably damaging 1.00
R1765:Tnc UTSW 4 64,013,994 (GRCm38) missense probably damaging 1.00
R1783:Tnc UTSW 4 64,018,096 (GRCm38) missense probably damaging 0.98
R1808:Tnc UTSW 4 63,999,931 (GRCm38) missense probably damaging 1.00
R1903:Tnc UTSW 4 64,000,062 (GRCm38) missense probably benign 0.00
R1932:Tnc UTSW 4 63,993,025 (GRCm38) critical splice donor site probably null
R1941:Tnc UTSW 4 64,014,964 (GRCm38) missense probably damaging 1.00
R1983:Tnc UTSW 4 63,984,630 (GRCm38) missense possibly damaging 0.95
R2024:Tnc UTSW 4 63,964,621 (GRCm38) missense probably damaging 1.00
R2075:Tnc UTSW 4 63,995,666 (GRCm38) missense possibly damaging 0.94
R2327:Tnc UTSW 4 63,975,238 (GRCm38) missense possibly damaging 0.78
R2444:Tnc UTSW 4 64,014,963 (GRCm38) missense probably damaging 1.00
R2982:Tnc UTSW 4 64,020,519 (GRCm38) missense possibly damaging 0.81
R3874:Tnc UTSW 4 64,008,710 (GRCm38) missense probably damaging 1.00
R4110:Tnc UTSW 4 64,014,951 (GRCm38) missense probably damaging 1.00
R4360:Tnc UTSW 4 64,016,924 (GRCm38) missense probably benign 0.35
R4371:Tnc UTSW 4 63,970,351 (GRCm38) missense probably damaging 1.00
R4434:Tnc UTSW 4 64,007,829 (GRCm38) missense possibly damaging 0.91
R4438:Tnc UTSW 4 64,007,829 (GRCm38) missense possibly damaging 0.91
R4570:Tnc UTSW 4 63,995,672 (GRCm38) missense probably damaging 0.99
R4595:Tnc UTSW 4 63,995,745 (GRCm38) missense probably damaging 1.00
R4749:Tnc UTSW 4 63,995,639 (GRCm38) missense possibly damaging 0.56
R4756:Tnc UTSW 4 63,967,343 (GRCm38) missense probably damaging 0.99
R4824:Tnc UTSW 4 64,017,620 (GRCm38) nonsense probably null
R4977:Tnc UTSW 4 64,006,248 (GRCm38) missense possibly damaging 0.82
R5001:Tnc UTSW 4 64,000,062 (GRCm38) missense probably benign 0.16
R5001:Tnc UTSW 4 63,984,489 (GRCm38) missense probably damaging 1.00
R5015:Tnc UTSW 4 64,006,502 (GRCm38) missense probably damaging 1.00
R5049:Tnc UTSW 4 64,017,986 (GRCm38) missense probably damaging 1.00
R5066:Tnc UTSW 4 63,975,229 (GRCm38) missense probably damaging 0.96
R5073:Tnc UTSW 4 64,020,411 (GRCm38) missense probably damaging 1.00
R5116:Tnc UTSW 4 63,967,215 (GRCm38) critical splice donor site probably null
R5195:Tnc UTSW 4 63,967,252 (GRCm38) missense probably damaging 1.00
R5200:Tnc UTSW 4 63,971,278 (GRCm38) missense probably damaging 1.00
R5221:Tnc UTSW 4 63,993,297 (GRCm38) nonsense probably null
R5237:Tnc UTSW 4 63,962,096 (GRCm38) missense probably damaging 1.00
R5265:Tnc UTSW 4 63,993,206 (GRCm38) missense probably benign 0.00
R5275:Tnc UTSW 4 63,964,730 (GRCm38) nonsense probably null
R5346:Tnc UTSW 4 64,008,655 (GRCm38) missense probably benign
R5409:Tnc UTSW 4 64,007,417 (GRCm38) missense probably damaging 1.00
R5409:Tnc UTSW 4 63,966,536 (GRCm38) missense probably damaging 1.00
R5469:Tnc UTSW 4 64,013,925 (GRCm38) splice site probably null
R5518:Tnc UTSW 4 64,017,679 (GRCm38) missense probably damaging 1.00
R5560:Tnc UTSW 4 64,008,709 (GRCm38) missense probably damaging 1.00
R5588:Tnc UTSW 4 64,006,422 (GRCm38) missense possibly damaging 0.57
R5686:Tnc UTSW 4 64,007,730 (GRCm38) splice site probably null
R5686:Tnc UTSW 4 64,008,795 (GRCm38) missense possibly damaging 0.78
R5837:Tnc UTSW 4 64,013,214 (GRCm38) missense probably damaging 1.00
R5976:Tnc UTSW 4 64,018,166 (GRCm38) missense probably benign 0.17
R6156:Tnc UTSW 4 63,970,352 (GRCm38) missense probably damaging 1.00
R6182:Tnc UTSW 4 64,008,796 (GRCm38) missense probably damaging 0.99
R6360:Tnc UTSW 4 64,000,733 (GRCm38) missense probably damaging 1.00
R6416:Tnc UTSW 4 64,007,816 (GRCm38) missense probably benign 0.05
R6778:Tnc UTSW 4 63,995,598 (GRCm38) missense probably benign 0.12
R6798:Tnc UTSW 4 63,965,604 (GRCm38) missense probably benign 0.02
R6799:Tnc UTSW 4 63,965,604 (GRCm38) missense probably benign 0.02
R6943:Tnc UTSW 4 63,982,745 (GRCm38) missense probably damaging 0.97
R7027:Tnc UTSW 4 63,984,589 (GRCm38) missense probably benign 0.02
R7183:Tnc UTSW 4 64,013,128 (GRCm38) missense probably damaging 1.00
R7204:Tnc UTSW 4 63,971,155 (GRCm38) splice site probably null
R7317:Tnc UTSW 4 63,972,722 (GRCm38) missense probably damaging 0.99
R7323:Tnc UTSW 4 63,971,232 (GRCm38) missense probably damaging 0.96
R7327:Tnc UTSW 4 63,964,762 (GRCm38) splice site probably null
R7382:Tnc UTSW 4 64,014,043 (GRCm38) nonsense probably null
R7399:Tnc UTSW 4 64,020,657 (GRCm38) start gained probably benign
R7479:Tnc UTSW 4 64,017,628 (GRCm38) missense possibly damaging 0.95
R7585:Tnc UTSW 4 64,020,411 (GRCm38) missense probably damaging 1.00
R7932:Tnc UTSW 4 64,008,620 (GRCm38) missense probably benign
R7947:Tnc UTSW 4 64,017,343 (GRCm38) missense probably damaging 1.00
R7974:Tnc UTSW 4 64,000,724 (GRCm38) missense possibly damaging 0.84
R7991:Tnc UTSW 4 64,008,746 (GRCm38) missense probably benign 0.42
R8004:Tnc UTSW 4 63,984,657 (GRCm38) missense probably benign 0.04
R8080:Tnc UTSW 4 63,976,469 (GRCm38) missense possibly damaging 0.52
R8109:Tnc UTSW 4 64,008,763 (GRCm38) missense probably benign 0.11
R8145:Tnc UTSW 4 64,017,479 (GRCm38) missense probably benign
R8340:Tnc UTSW 4 64,007,799 (GRCm38) missense probably damaging 1.00
R8360:Tnc UTSW 4 63,967,274 (GRCm38) missense probably benign 0.00
R8671:Tnc UTSW 4 64,017,446 (GRCm38) missense probably damaging 1.00
R8691:Tnc UTSW 4 63,962,076 (GRCm38) missense probably damaging 1.00
R8759:Tnc UTSW 4 64,006,264 (GRCm38) missense possibly damaging 0.86
R8864:Tnc UTSW 4 63,993,059 (GRCm38) missense probably damaging 0.98
R8927:Tnc UTSW 4 64,007,358 (GRCm38) missense probably damaging 1.00
R8928:Tnc UTSW 4 64,007,358 (GRCm38) missense probably damaging 1.00
R8949:Tnc UTSW 4 64,008,850 (GRCm38) missense probably damaging 1.00
R8956:Tnc UTSW 4 64,000,733 (GRCm38) missense probably damaging 1.00
R9016:Tnc UTSW 4 64,017,094 (GRCm38) missense probably benign 0.23
R9049:Tnc UTSW 4 64,000,010 (GRCm38) missense possibly damaging 0.83
R9097:Tnc UTSW 4 63,970,385 (GRCm38) missense possibly damaging 0.62
R9114:Tnc UTSW 4 63,972,736 (GRCm38) missense probably benign 0.03
R9151:Tnc UTSW 4 64,020,449 (GRCm38) missense possibly damaging 0.46
R9488:Tnc UTSW 4 63,995,705 (GRCm38) missense probably damaging 0.99
R9537:Tnc UTSW 4 63,966,584 (GRCm38) missense probably damaging 0.99
R9666:Tnc UTSW 4 64,007,808 (GRCm38) missense probably damaging 1.00
R9700:Tnc UTSW 4 64,014,949 (GRCm38) missense probably damaging 0.99
R9703:Tnc UTSW 4 63,971,175 (GRCm38) missense probably benign 0.00
R9771:Tnc UTSW 4 64,007,363 (GRCm38) missense probably damaging 1.00
S24628:Tnc UTSW 4 64,018,012 (GRCm38) missense probably damaging 1.00
Z1177:Tnc UTSW 4 64,007,426 (GRCm38) nonsense probably null
Z1177:Tnc UTSW 4 63,960,544 (GRCm38) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACACCCAGGGTCTCATTTGC -3'
(R):5'- ACGTGGTCACTGTATCTGCTG -3'

Sequencing Primer
(F):5'- GCCATTTAACCCTAATGTTGCATG -3'
(R):5'- CTTTCATGTCACAGTGTAACCATG -3'
Posted On 2016-04-27