Incidental Mutation 'R4957:Ybx1'
ID 381637
Institutional Source Beutler Lab
Gene Symbol Ybx1
Ensembl Gene ENSMUSG00000028639
Gene Name Y box protein 1
Synonyms dbpB, DNA binding protein B, EF1A, MSY1, Nsep1, YB-1
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4957 (G1)
Quality Score 138
Status Validated
Chromosome 4
Chromosomal Location 119277981-119294604 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to T at 119278938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079644] [ENSMUST00000127737]
AlphaFold P62960
Predicted Effect probably benign
Transcript: ENSMUST00000079644
SMART Domains Protein: ENSMUSP00000078589
Gene: ENSMUSG00000028639

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 25 48 N/A INTRINSIC
CSP 58 126 8.65e-24 SMART
low complexity region 140 159 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
low complexity region 179 206 N/A INTRINSIC
low complexity region 236 254 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127737
SMART Domains Protein: ENSMUSP00000117225
Gene: ENSMUSG00000028639

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145976
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit embryonic and perinatal lethality and are severely growth retarded. Some mice exhibit craniofacial defects and respiratory failure. MEFs are more sensitive to oxidative stress resulting in premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Ybx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ybx1 APN 4 119282312 missense probably damaging 1.00
IGL02635:Ybx1 APN 4 119279089 missense possibly damaging 0.88
BB001:Ybx1 UTSW 4 119282279 missense probably damaging 0.97
BB011:Ybx1 UTSW 4 119282279 missense probably damaging 0.97
R0136:Ybx1 UTSW 4 119282354 missense possibly damaging 0.57
R0270:Ybx1 UTSW 4 119281591 missense probably benign 0.11
R4911:Ybx1 UTSW 4 119282813 missense probably benign 0.13
R4986:Ybx1 UTSW 4 119282430 missense probably damaging 0.99
R5205:Ybx1 UTSW 4 119279151 missense probably damaging 1.00
R7098:Ybx1 UTSW 4 119282853 missense possibly damaging 0.65
R7706:Ybx1 UTSW 4 119278967 makesense probably null
R7924:Ybx1 UTSW 4 119282279 missense probably damaging 0.97
R8901:Ybx1 UTSW 4 119281588 missense probably damaging 0.97
R9213:Ybx1 UTSW 4 119281597 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGTCTTCAGAGCACAGGAAG -3'
(R):5'- TCGCCAAAGACAGCCTAGAG -3'

Sequencing Primer
(F):5'- CACAGGAAGTAAGACTTTGCTTAGC -3'
(R):5'- AGGTCAGCAGCCACCTC -3'
Posted On 2016-04-27