Mutagenetix > Incidental Mutation

Incidental Mutation 'R4957:Ybx1'

381637

Institutional Source

Beutler Lab

Gene Symbol

Ybx1

Ensembl Gene

ENSMUSG00000028639

Gene Name

Y box protein 1

Synonyms

dbpB, DNA binding protein B, EF1A, MSY1, Nsep1, YB-1

MMRRC Submission

042554-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4957 (G1)

Quality Score

138

Status

Validated

Chromosome

Chromosomal Location

119277981-119294604 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

A to T at 119278938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079644] [ENSMUST00000127737]

AlphaFold

P62960

Predicted Effect

probably benign
Transcript: ENSMUST00000079644

SMART Domains

Protein: ENSMUSP00000078589
Gene: ENSMUSG00000028639

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
low complexity region	25	48	N/A	INTRINSIC
CSP	58	126	8.65e-24	SMART
low complexity region	140	159	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
low complexity region	179	206	N/A	INTRINSIC
low complexity region	236	254	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127737

SMART Domains

Protein: ENSMUSP00000117225
Gene: ENSMUSG00000028639

Domain	Start	End	E-Value	Type
low complexity region	28	47	N/A	INTRINSIC
low complexity region	50	62	N/A	INTRINSIC
low complexity region	67	94	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145976

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit embryonic and perinatal lethality and are severely growth retarded. Some mice exhibit craniofacial defects and respiratory failure. MEFs are more sensitive to oxidative stress resulting in premature senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Arhgap33	C	T	7: 30,532,361	G101R	probably damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Clptm1l	T	A	13: 73,611,196	I245N	possibly damaging	Het
Clptm1l	T	C	13: 73,612,428	I310T	probably damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Crebbp	T	C	16: 4,117,367	Q460R	probably benign	Het
Dnah17	A	T	11: 118,074,298	I2306N	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mme	T	A	3: 63,343,489		probably benign	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Zfp39	T	A	11: 58,891,231	Y235F	possibly damaging	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Ybx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02000:Ybx1	APN	4	119282312	missense	probably damaging	1.00
IGL02635:Ybx1	APN	4	119279089	missense	possibly damaging	0.88
BB001:Ybx1	UTSW	4	119282279	missense	probably damaging	0.97
BB011:Ybx1	UTSW	4	119282279	missense	probably damaging	0.97
R0136:Ybx1	UTSW	4	119282354	missense	possibly damaging	0.57
R0270:Ybx1	UTSW	4	119281591	missense	probably benign	0.11
R4911:Ybx1	UTSW	4	119282813	missense	probably benign	0.13
R4986:Ybx1	UTSW	4	119282430	missense	probably damaging	0.99
R5205:Ybx1	UTSW	4	119279151	missense	probably damaging	1.00
R7098:Ybx1	UTSW	4	119282853	missense	possibly damaging	0.65
R7706:Ybx1	UTSW	4	119278967	makesense	probably null
R7924:Ybx1	UTSW	4	119282279	missense	probably damaging	0.97
R8901:Ybx1	UTSW	4	119281588	missense	probably damaging	0.97
R9213:Ybx1	UTSW	4	119281597	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- CTGTCTTCAGAGCACAGGAAG -3'
(R):5'- TCGCCAAAGACAGCCTAGAG -3'

Sequencing Primer
(F):5'- CACAGGAAGTAAGACTTTGCTTAGC -3'
(R):5'- AGGTCAGCAGCCACCTC -3'

Posted On

2016-04-27