Incidental Mutation 'R4957:Tnfrsf1b'
ID 381639
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1b
Ensembl Gene ENSMUSG00000028599
Gene Name tumor necrosis factor receptor superfamily, member 1b
Synonyms TNFalpha-R2, TNFBR, CD120b, TNFR80, TNF-R-II, TNF-R75, p75 TNFR, Tnfr2, p75, TNF-R2, TNFRII, TNF-alphaR2
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock # R4957 (G1)
Quality Score 131
Status Validated
Chromosome 4
Chromosomal Location 145213463-145246870 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 145246757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 15 (Q15H)
Ref Sequence ENSEMBL: ENSMUSP00000030336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030336] [ENSMUST00000143055]
AlphaFold P25119
Predicted Effect probably damaging
Transcript: ENSMUST00000030336
AA Change: Q15H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030336
Gene: ENSMUSG00000028599
AA Change: Q15H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TNFR 40 76 2.15e-9 SMART
TNFR 79 119 2.19e-10 SMART
TNFR 121 163 7.27e-7 SMART
TNFR 166 202 2.22e-2 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143055
AA Change: Q15H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115702
Gene: ENSMUSG00000028599
AA Change: Q15H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. The function of IAPs in TNF-receptor signalling is unknown, however, c-IAP1 is thought to potentiate TNF-induced apoptosis by the ubiquitination and degradation of TNF-receptor-associated factor 2, which mediates anti-apoptotic signals. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered inflammatory responses in a variety of experimental conditions, impaired recovery from spinal cord injury, enhanced ischemia-reperfusion-induced retinal damage, and resistance to cerebral malaria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Tnfrsf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Tnfrsf1b APN 4 145225416 missense probably damaging 1.00
IGL01716:Tnfrsf1b APN 4 145215923 missense probably damaging 0.97
IGL01974:Tnfrsf1b APN 4 145215851 missense probably damaging 1.00
IGL02631:Tnfrsf1b APN 4 145224828 missense probably damaging 1.00
R0011:Tnfrsf1b UTSW 4 145222966 missense possibly damaging 0.77
R0135:Tnfrsf1b UTSW 4 145229046 missense probably benign 0.15
R0194:Tnfrsf1b UTSW 4 145224812 missense probably benign 0.04
R0761:Tnfrsf1b UTSW 4 145216100 missense possibly damaging 0.95
R1124:Tnfrsf1b UTSW 4 145224356 missense probably benign 0.23
R1696:Tnfrsf1b UTSW 4 145227474 missense probably benign
R3692:Tnfrsf1b UTSW 4 145227522 missense probably benign 0.01
R4248:Tnfrsf1b UTSW 4 145215965 missense probably benign 0.01
R4409:Tnfrsf1b UTSW 4 145224285 nonsense probably null
R4957:Tnfrsf1b UTSW 4 145246758 missense possibly damaging 0.90
R5180:Tnfrsf1b UTSW 4 145227497 missense probably damaging 1.00
R5425:Tnfrsf1b UTSW 4 145229108 critical splice acceptor site probably null
R6163:Tnfrsf1b UTSW 4 145219907 missense probably benign 0.24
R7055:Tnfrsf1b UTSW 4 145224887 missense probably damaging 1.00
R7891:Tnfrsf1b UTSW 4 145229090 missense probably damaging 1.00
R8796:Tnfrsf1b UTSW 4 145219915 missense possibly damaging 0.95
R8919:Tnfrsf1b UTSW 4 145223580 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATAAGGCTGTCGGGAAC -3'
(R):5'- TCTGTGTAAAGAGGCGTGTC -3'

Sequencing Primer
(F):5'- AGGATCCCAACGGGCCAG -3'
(R):5'- AGGCGTGTCCTCAGGGC -3'
Posted On 2016-04-27