Incidental Mutation 'R4957:Creb5'
ID 381644
Institutional Source Beutler Lab
Gene Symbol Creb5
Ensembl Gene ENSMUSG00000053007
Gene Name cAMP responsive element binding protein 5
Synonyms Crebpa, D430026C09Rik
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4957 (G1)
Quality Score 190
Status Validated
Chromosome 6
Chromosomal Location 53287270-53700376 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 53693922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047450] [ENSMUST00000203487] [ENSMUST00000203528] [ENSMUST00000205120]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000047450
SMART Domains Protein: ENSMUSP00000038532
Gene: ENSMUSG00000053007

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203487
SMART Domains Protein: ENSMUSP00000144851
Gene: ENSMUSG00000053007

DomainStartEndE-ValueType
ZnF_C2H2 16 40 7.9e-5 SMART
low complexity region 268 329 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
BRLZ 373 437 8e-23 SMART
low complexity region 455 469 N/A INTRINSIC
low complexity region 480 495 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203528
SMART Domains Protein: ENSMUSP00000144979
Gene: ENSMUSG00000053007

DomainStartEndE-ValueType
ZnF_C2H2 9 33 7.9e-5 SMART
low complexity region 261 322 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
BRLZ 366 430 8e-23 SMART
low complexity region 448 462 N/A INTRINSIC
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205120
SMART Domains Protein: ENSMUSP00000144719
Gene: ENSMUSG00000053007

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CRE (cAMP response element)-binding protein family. Members of this family contain zinc-finger and bZIP DNA-binding domains. The encoded protein specifically binds to CRE as a homodimer or a heterodimer with c-Jun or CRE-BP1, and functions as a CRE-dependent trans-activator. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Creb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Creb5 APN 6 53604458 splice site probably benign
IGL02475:Creb5 APN 6 53693924 missense probably damaging 0.98
IGL02663:Creb5 APN 6 53680961 missense probably damaging 0.99
R0054:Creb5 UTSW 6 53447657 missense probably benign 0.27
R0452:Creb5 UTSW 6 53604542 missense possibly damaging 0.94
R4580:Creb5 UTSW 6 53604534 missense possibly damaging 0.46
R4809:Creb5 UTSW 6 53610426 missense probably null 0.71
R5375:Creb5 UTSW 6 53681017 missense possibly damaging 0.79
R6552:Creb5 UTSW 6 53685384 missense probably damaging 0.99
R6616:Creb5 UTSW 6 53685310 missense possibly damaging 0.96
R6679:Creb5 UTSW 6 53685469 missense possibly damaging 0.51
R6745:Creb5 UTSW 6 53604532 missense probably benign 0.03
R7428:Creb5 UTSW 6 53681158 missense unknown
R7581:Creb5 UTSW 6 53681237 missense probably damaging 0.99
X0065:Creb5 UTSW 6 53685401 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGCTTTTCCCATAGCTATGAG -3'
(R):5'- TACGGCATGCTACAGCTCTTC -3'

Sequencing Primer
(F):5'- TCCCATAGCTATGAGCCTGG -3'
(R):5'- TCTCAAAGGCCAGGTTTGAC -3'
Posted On 2016-04-27