Incidental Mutation 'R4957:Gmcl1'
ID 381645
Institutional Source Beutler Lab
Gene Symbol Gmcl1
Ensembl Gene ENSMUSG00000001157
Gene Name germ cell-less, spermatogenesis associated 1
Synonyms Gcl, mglc-1, 2810049L19Rik
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 86691768-86733383 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86710521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 354 (P354S)
Ref Sequence ENSEMBL: ENSMUSP00000001185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001185]
AlphaFold Q920G9
Predicted Effect probably damaging
Transcript: ENSMUST00000001185
AA Change: P354S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001185
Gene: ENSMUSG00000001157
AA Change: P354S

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
BTB 106 206 3.76e-11 SMART
BACK 211 298 3.6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203741
Meta Mutation Damage Score 0.8299 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired nuclear membrane integrity in liver, endocrine pancreas, and testis. Mutant males show reduced fertility with decreased chromatin condensation and morphologically abnormal sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Gmcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Gmcl1 APN 6 86707457 missense possibly damaging 0.52
IGL03354:Gmcl1 APN 6 86726158 missense probably damaging 1.00
PIT4453001:Gmcl1 UTSW 6 86704538 missense probably benign 0.09
R0149:Gmcl1 UTSW 6 86732909 critical splice donor site probably null
R1398:Gmcl1 UTSW 6 86714262 splice site probably benign
R1869:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R1871:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R2851:Gmcl1 UTSW 6 86726177 missense probably damaging 0.99
R4584:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4585:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4664:Gmcl1 UTSW 6 86732998 missense probably benign 0.30
R4851:Gmcl1 UTSW 6 86704556 missense possibly damaging 0.64
R5326:Gmcl1 UTSW 6 86726145 missense possibly damaging 0.96
R5482:Gmcl1 UTSW 6 86718073 missense probably damaging 1.00
R5496:Gmcl1 UTSW 6 86697525 missense probably damaging 0.97
R5817:Gmcl1 UTSW 6 86714248 missense probably damaging 1.00
R5854:Gmcl1 UTSW 6 86714259 splice site silent
R5891:Gmcl1 UTSW 6 86707443 missense probably damaging 1.00
R5895:Gmcl1 UTSW 6 86711614 missense probably benign 0.03
R6012:Gmcl1 UTSW 6 86721412 missense probably damaging 1.00
R6257:Gmcl1 UTSW 6 86700641 missense possibly damaging 0.82
R7693:Gmcl1 UTSW 6 86714257 missense probably benign 0.10
R7698:Gmcl1 UTSW 6 86707415 missense probably benign 0.00
R7999:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8049:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8093:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8109:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8110:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8111:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8154:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8157:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8208:Gmcl1 UTSW 6 86721399 missense probably damaging 0.99
R8250:Gmcl1 UTSW 6 86721402 missense possibly damaging 0.72
R8509:Gmcl1 UTSW 6 86722607 missense probably damaging 1.00
R9264:Gmcl1 UTSW 6 86714213 missense probably benign 0.25
R9308:Gmcl1 UTSW 6 86714257 missense possibly damaging 0.87
R9350:Gmcl1 UTSW 6 86700587 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGCAAGCACTTTAACACTG -3'
(R):5'- CAGCACATTTGACAAGAATGCTG -3'

Sequencing Primer
(F):5'- GGCAAGCACTTTAACACTGAAATATG -3'
(R):5'- TCCTTGAAACTGAGCAGG -3'
Posted On 2016-04-27