Incidental Mutation 'R4957:Usp5'
ID 381648
Institutional Source Beutler Lab
Gene Symbol Usp5
Ensembl Gene ENSMUSG00000038429
Gene Name ubiquitin specific peptidase 5 (isopeptidase T)
Synonyms Ucht
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124815019-124829484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 124822630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 318 (K318N)
Ref Sequence ENSEMBL: ENSMUSP00000041299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000142058] [ENSMUST00000153306]
AlphaFold P56399
Predicted Effect possibly damaging
Transcript: ENSMUST00000047510
AA Change: K318N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 656 694 3.12e-7 SMART
UBA 724 761 8.63e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122110
AA Change: K318N

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 633 671 3.12e-7 SMART
UBA 701 738 8.63e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141042
Predicted Effect possibly damaging
Transcript: ENSMUST00000142058
AA Change: K300N

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429
AA Change: K300N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-20 BLAST
ZnF_UBP 180 235 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146098
Predicted Effect probably benign
Transcript: ENSMUST00000153306
SMART Domains Protein: ENSMUSP00000118200
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
Blast:ZnF_UBP 1 32 3e-7 BLAST
ZnF_UBP 152 207 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154189
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Usp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp5 APN 6 124829353 missense probably benign 0.00
IGL00905:Usp5 APN 6 124815613 missense probably damaging 1.00
IGL01584:Usp5 APN 6 124819387 missense probably damaging 1.00
IGL01642:Usp5 APN 6 124820453 missense probably damaging 0.99
IGL01787:Usp5 APN 6 124824226 missense possibly damaging 0.95
IGL02394:Usp5 APN 6 124822709 missense probably damaging 1.00
IGL02677:Usp5 APN 6 124819426 missense probably damaging 1.00
IGL03392:Usp5 APN 6 124826387 missense probably damaging 1.00
BB004:Usp5 UTSW 6 124824229 missense probably benign 0.06
BB014:Usp5 UTSW 6 124824229 missense probably benign 0.06
R0594:Usp5 UTSW 6 124817424 missense probably damaging 0.99
R1522:Usp5 UTSW 6 124825166 missense probably benign
R1719:Usp5 UTSW 6 124823460 missense possibly damaging 0.94
R2185:Usp5 UTSW 6 124817410 missense probably damaging 0.99
R3115:Usp5 UTSW 6 124815597 missense probably damaging 1.00
R4196:Usp5 UTSW 6 124824938 missense possibly damaging 0.78
R4347:Usp5 UTSW 6 124821195 missense probably damaging 1.00
R4386:Usp5 UTSW 6 124818474 critical splice donor site probably null
R4500:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4501:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4526:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4527:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4528:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4684:Usp5 UTSW 6 124817956 missense probably damaging 1.00
R4912:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4913:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4954:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4956:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4958:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R5071:Usp5 UTSW 6 124826379 missense probably benign 0.13
R6020:Usp5 UTSW 6 124817613 unclassified probably benign
R6236:Usp5 UTSW 6 124818478 missense probably benign 0.05
R6370:Usp5 UTSW 6 124820428 missense probably benign 0.01
R7090:Usp5 UTSW 6 124829394 start codon destroyed probably null
R7317:Usp5 UTSW 6 124826318 missense probably damaging 0.98
R7447:Usp5 UTSW 6 124821114 missense probably damaging 1.00
R7572:Usp5 UTSW 6 124818007 missense probably damaging 0.99
R7598:Usp5 UTSW 6 124826379 missense possibly damaging 0.73
R7927:Usp5 UTSW 6 124824229 missense probably benign 0.06
R7931:Usp5 UTSW 6 124824446 intron probably benign
R8089:Usp5 UTSW 6 124820410 critical splice donor site probably null
R8361:Usp5 UTSW 6 124824985 missense probably damaging 1.00
R8544:Usp5 UTSW 6 124823517 missense probably damaging 1.00
R8679:Usp5 UTSW 6 124817431 missense possibly damaging 0.94
R9115:Usp5 UTSW 6 124826421 missense probably damaging 0.97
R9128:Usp5 UTSW 6 124823451 critical splice donor site probably null
R9227:Usp5 UTSW 6 124818636 missense probably damaging 1.00
X0058:Usp5 UTSW 6 124824176 missense probably damaging 1.00
Z1177:Usp5 UTSW 6 124825148 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGGCCCTCCTTAAGTAATGC -3'
(R):5'- CGAGGATGAGTCTTAGTCCAGAG -3'

Sequencing Primer
(F):5'- GGCCCTCCTTAAGTAATGCTAAAATG -3'
(R):5'- TCTTAGTCCAGAGCTTAGAGACG -3'
Posted On 2016-04-27