Incidental Mutation 'R4957:Atf7ip'
ID 381649
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Name activating transcription factor 7 interacting protein
Synonyms Mcaf1, 2610204M12Rik, AM, ATFa-associated Modulator
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock # R4957 (G1)
Quality Score 175
Status Validated
Chromosome 6
Chromosomal Location 136506167-136610862 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 136606810 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1280 (R1280C)
Ref Sequence ENSEMBL: ENSMUSP00000032335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335]
AlphaFold Q7TT18
Predicted Effect probably damaging
Transcript: ENSMUST00000032335
AA Change: R1280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: R1280C

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185332
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136560681 missense probably benign 0.00
IGL01483:Atf7ip APN 6 136587459 missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136606720 missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136593118 missense probably benign 0.01
IGL02547:Atf7ip APN 6 136603276 splice site probably benign
IGL02869:Atf7ip APN 6 136606579 missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136560688 missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136606727 missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136605382 missense possibly damaging 0.79
fuegado UTSW 6 136560710 missense probably benign
Outtahere UTSW 6 136565106 missense probably damaging 1.00
Severance UTSW 6 136559816 missense probably damaging 1.00
R0024:Atf7ip UTSW 6 136599820 splice site probably benign
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136560989 missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136561163 missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136560012 missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136609192 unclassified probably benign
R0526:Atf7ip UTSW 6 136559805 missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136606867 missense probably damaging 0.96
R1663:Atf7ip UTSW 6 136603324 missense possibly damaging 0.93
R1793:Atf7ip UTSW 6 136609219 unclassified probably benign
R1822:Atf7ip UTSW 6 136587260 missense probably benign 0.11
R1873:Atf7ip UTSW 6 136559888 missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136560780 missense probably benign 0.41
R2059:Atf7ip UTSW 6 136609348 unclassified probably benign
R2134:Atf7ip UTSW 6 136605487 missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136566651 missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136575324 unclassified probably benign
R3755:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3756:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3890:Atf7ip UTSW 6 136587045 missense possibly damaging 0.48
R4190:Atf7ip UTSW 6 136587501 missense probably damaging 1.00
R4494:Atf7ip UTSW 6 136563749 splice site probably null
R4588:Atf7ip UTSW 6 136599694 missense probably benign
R4618:Atf7ip UTSW 6 136565106 missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136561194 missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136596491 missense probably benign 0.06
R4922:Atf7ip UTSW 6 136560041 missense possibly damaging 0.91
R4956:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136582428 missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136561388 missense probably damaging 0.99
R5075:Atf7ip UTSW 6 136560234 missense probably benign
R5279:Atf7ip UTSW 6 136603379 nonsense probably null
R5445:Atf7ip UTSW 6 136587257 missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136606814 missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136566787 critical splice donor site probably null
R5891:Atf7ip UTSW 6 136559977 missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136571502 missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136559819 missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136582391 missense probably damaging 1.00
R6880:Atf7ip UTSW 6 136561040 missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136559757 splice site probably null
R7075:Atf7ip UTSW 6 136596515 critical splice donor site probably null
R7308:Atf7ip UTSW 6 136565089 missense probably benign 0.01
R7365:Atf7ip UTSW 6 136560710 missense probably benign
R7556:Atf7ip UTSW 6 136561241 missense probably damaging 0.99
R7812:Atf7ip UTSW 6 136603417 missense probably damaging 0.96
R7973:Atf7ip UTSW 6 136561064 nonsense probably null
R8032:Atf7ip UTSW 6 136565112 missense probably benign 0.00
R8203:Atf7ip UTSW 6 136606783 missense probably damaging 0.99
R8274:Atf7ip UTSW 6 136560990 missense probably benign
R8784:Atf7ip UTSW 6 136599650 missense probably damaging 0.99
R8785:Atf7ip UTSW 6 136587164 missense probably damaging 0.97
R8885:Atf7ip UTSW 6 136587143 missense probably benign 0.06
R8957:Atf7ip UTSW 6 136566703 missense probably null 0.99
R9042:Atf7ip UTSW 6 136561265 nonsense probably null
R9531:Atf7ip UTSW 6 136560877 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTCAGAATGGCATTGTTC -3'
(R):5'- GGAGATCTTGCACAAGGTGG -3'

Sequencing Primer
(F):5'- TCCTGGAAGTGGACCGAAGC -3'
(R):5'- CTTGCACAAGGTGGATTTTTACAG -3'
Posted On 2016-04-27