Mutagenetix > Incidental Mutation

Incidental Mutation 'R4957:Atf7ip'

381649

Institutional Source

Beutler Lab

Gene Symbol

Atf7ip

Ensembl Gene

ENSMUSG00000030213

Gene Name

activating transcription factor 7 interacting protein

Synonyms

Mcaf1, 2610204M12Rik, AM, ATFa-associated Modulator

MMRRC Submission

042554-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.931) question?

Stock #

R4957 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

136506167-136610862 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 136606810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1280 (R1280C)

Ref Sequence

ENSEMBL: ENSMUSP00000032335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032335]

AlphaFold

Q7TT18

Predicted Effect

probably damaging
Transcript: ENSMUST00000032335
AA Change: R1280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: R1280C

Domain	Start	End	E-Value	Type
internal_repeat_1	123	144	9.59e-5	PROSPERO
internal_repeat_1	143	164	9.59e-5	PROSPERO
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC
low complexity region	567	582	N/A	INTRINSIC
Pfam:ATF7IP_BD	598	813	5.5e-62	PFAM
low complexity region	864	889	N/A	INTRINSIC
PDB:2RPQ\|B	974	1017	5e-7	PDB
low complexity region	1022	1036	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1168	1192	N/A	INTRINSIC
FN3	1194	1288	3.4e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185332

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Arhgap33	C	T	7: 30,532,361	G101R	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Clptm1l	T	A	13: 73,611,196	I245N	possibly damaging	Het
Clptm1l	T	C	13: 73,612,428	I310T	probably damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Crebbp	T	C	16: 4,117,367	Q460R	probably benign	Het
Dnah17	A	T	11: 118,074,298	I2306N	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mme	T	A	3: 63,343,489		probably benign	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Ybx1	A	T	4: 119,278,938		probably benign	Het
Zfp39	T	A	11: 58,891,231	Y235F	possibly damaging	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Atf7ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Atf7ip	APN	6	136560681	missense	probably benign	0.00
IGL01483:Atf7ip	APN	6	136587459	missense	probably damaging	1.00
IGL02313:Atf7ip	APN	6	136606720	missense	probably damaging	0.99
IGL02319:Atf7ip	APN	6	136593118	missense	probably benign	0.01
IGL02547:Atf7ip	APN	6	136603276	splice site	probably benign
IGL02869:Atf7ip	APN	6	136606579	missense	probably damaging	0.99
IGL02895:Atf7ip	APN	6	136560688	missense	probably damaging	0.99
IGL02967:Atf7ip	APN	6	136606727	missense	probably damaging	0.98
IGL03026:Atf7ip	APN	6	136605382	missense	possibly damaging	0.79
fuegado	UTSW	6	136560710	missense	probably benign
Outtahere	UTSW	6	136565106	missense	probably damaging	1.00
Severance	UTSW	6	136559816	missense	probably damaging	1.00
R0024:Atf7ip	UTSW	6	136599820	splice site	probably benign
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0325:Atf7ip	UTSW	6	136560989	missense	possibly damaging	0.86
R0331:Atf7ip	UTSW	6	136561163	missense	possibly damaging	0.94
R0415:Atf7ip	UTSW	6	136560012	missense	possibly damaging	0.92
R0490:Atf7ip	UTSW	6	136609192	unclassified	probably benign
R0526:Atf7ip	UTSW	6	136559805	missense	probably damaging	1.00
R1503:Atf7ip	UTSW	6	136606867	missense	probably damaging	0.96
R1663:Atf7ip	UTSW	6	136603324	missense	possibly damaging	0.93
R1793:Atf7ip	UTSW	6	136609219	unclassified	probably benign
R1822:Atf7ip	UTSW	6	136587260	missense	probably benign	0.11
R1873:Atf7ip	UTSW	6	136559888	missense	probably damaging	1.00
R1937:Atf7ip	UTSW	6	136560780	missense	probably benign	0.41
R2059:Atf7ip	UTSW	6	136609348	unclassified	probably benign
R2134:Atf7ip	UTSW	6	136605487	missense	possibly damaging	0.80
R2679:Atf7ip	UTSW	6	136566651	missense	possibly damaging	0.62
R3430:Atf7ip	UTSW	6	136575324	unclassified	probably benign
R3755:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3756:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3890:Atf7ip	UTSW	6	136587045	missense	possibly damaging	0.48
R4190:Atf7ip	UTSW	6	136587501	missense	probably damaging	1.00
R4494:Atf7ip	UTSW	6	136563749	splice site	probably null
R4588:Atf7ip	UTSW	6	136599694	missense	probably benign
R4618:Atf7ip	UTSW	6	136565106	missense	probably damaging	1.00
R4705:Atf7ip	UTSW	6	136561194	missense	probably damaging	1.00
R4838:Atf7ip	UTSW	6	136596491	missense	probably benign	0.06
R4922:Atf7ip	UTSW	6	136560041	missense	possibly damaging	0.91
R4956:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R4958:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R5000:Atf7ip	UTSW	6	136582428	missense	probably damaging	1.00
R5001:Atf7ip	UTSW	6	136561388	missense	probably damaging	0.99
R5075:Atf7ip	UTSW	6	136560234	missense	probably benign
R5279:Atf7ip	UTSW	6	136603379	nonsense	probably null
R5445:Atf7ip	UTSW	6	136587257	missense	probably damaging	1.00
R5844:Atf7ip	UTSW	6	136606814	missense	probably damaging	1.00
R5850:Atf7ip	UTSW	6	136566787	critical splice donor site	probably null
R5891:Atf7ip	UTSW	6	136559977	missense	possibly damaging	0.64
R5987:Atf7ip	UTSW	6	136571502	missense	probably damaging	1.00
R6168:Atf7ip	UTSW	6	136559819	missense	probably damaging	1.00
R6726:Atf7ip	UTSW	6	136582391	missense	probably damaging	1.00
R6880:Atf7ip	UTSW	6	136561040	missense	probably damaging	1.00
R6924:Atf7ip	UTSW	6	136559757	splice site	probably null
R7075:Atf7ip	UTSW	6	136596515	critical splice donor site	probably null
R7308:Atf7ip	UTSW	6	136565089	missense	probably benign	0.01
R7365:Atf7ip	UTSW	6	136560710	missense	probably benign
R7556:Atf7ip	UTSW	6	136561241	missense	probably damaging	0.99
R7812:Atf7ip	UTSW	6	136603417	missense	probably damaging	0.96
R7973:Atf7ip	UTSW	6	136561064	nonsense	probably null
R8032:Atf7ip	UTSW	6	136565112	missense	probably benign	0.00
R8203:Atf7ip	UTSW	6	136606783	missense	probably damaging	0.99
R8274:Atf7ip	UTSW	6	136560990	missense	probably benign
R8784:Atf7ip	UTSW	6	136599650	missense	probably damaging	0.99
R8785:Atf7ip	UTSW	6	136587164	missense	probably damaging	0.97
R8885:Atf7ip	UTSW	6	136587143	missense	probably benign	0.06
R8957:Atf7ip	UTSW	6	136566703	missense	probably null	0.99
R9042:Atf7ip	UTSW	6	136561265	nonsense	probably null
R9531:Atf7ip	UTSW	6	136560877	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGAGTCAGAATGGCATTGTTC -3'
(R):5'- GGAGATCTTGCACAAGGTGG -3'

Sequencing Primer
(F):5'- TCCTGGAAGTGGACCGAAGC -3'
(R):5'- CTTGCACAAGGTGGATTTTTACAG -3'

Posted On

2016-04-27