Incidental Mutation 'R4957:Arhgap33'
ID 381650
Institutional Source Beutler Lab
Gene Symbol Arhgap33
Ensembl Gene ENSMUSG00000036882
Gene Name Rho GTPase activating protein 33
Synonyms Snx26, NOMA-GAP, Tcgap
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30522226-30535060 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30532361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 101 (G101R)
Ref Sequence ENSEMBL: ENSMUSP00000147001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208491] [ENSMUST00000208522] [ENSMUST00000208538]
AlphaFold Q80YF9
Predicted Effect possibly damaging
Transcript: ENSMUST00000044338
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882
AA Change: G101R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
SH3 213 271 5.32e-12 SMART
low complexity region 318 335 N/A INTRINSIC
RhoGAP 350 531 4.05e-67 SMART
low complexity region 582 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 694 733 N/A INTRINSIC
low complexity region 770 798 N/A INTRINSIC
low complexity region 832 850 N/A INTRINSIC
low complexity region 894 940 N/A INTRINSIC
low complexity region 979 988 N/A INTRINSIC
low complexity region 1076 1086 N/A INTRINSIC
low complexity region 1158 1166 N/A INTRINSIC
low complexity region 1194 1216 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207637
Predicted Effect possibly damaging
Transcript: ENSMUST00000207858
AA Change: G77R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207860
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000208491
AA Change: G101R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000208522
Predicted Effect possibly damaging
Transcript: ENSMUST00000208538
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208723
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Arhgap33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Arhgap33 APN 7 30529946 missense probably damaging 0.99
IGL02176:Arhgap33 APN 7 30524051 missense possibly damaging 0.76
IGL02430:Arhgap33 APN 7 30522760 missense probably benign 0.07
IGL03091:Arhgap33 APN 7 30528293 missense probably damaging 1.00
R0276:Arhgap33 UTSW 7 30523244 missense probably benign 0.01
R0494:Arhgap33 UTSW 7 30524496 missense probably damaging 0.98
R0597:Arhgap33 UTSW 7 30526446 missense probably damaging 1.00
R0717:Arhgap33 UTSW 7 30528349 missense probably damaging 1.00
R1661:Arhgap33 UTSW 7 30532323 missense probably damaging 1.00
R1761:Arhgap33 UTSW 7 30533063 splice site probably null
R1882:Arhgap33 UTSW 7 30522809 missense probably damaging 1.00
R2161:Arhgap33 UTSW 7 30528650 splice site probably null
R2566:Arhgap33 UTSW 7 30527229 missense probably damaging 1.00
R4353:Arhgap33 UTSW 7 30524136 missense possibly damaging 0.95
R4552:Arhgap33 UTSW 7 30519108 unclassified probably benign
R4778:Arhgap33 UTSW 7 30532093 missense probably benign
R4887:Arhgap33 UTSW 7 30532192 missense probably damaging 0.99
R5001:Arhgap33 UTSW 7 30533016 missense possibly damaging 0.95
R5140:Arhgap33 UTSW 7 30528301 missense probably damaging 1.00
R5585:Arhgap33 UTSW 7 30523835 missense probably benign 0.00
R5704:Arhgap33 UTSW 7 30519620 unclassified probably benign
R5805:Arhgap33 UTSW 7 30526414 missense probably benign 0.01
R6476:Arhgap33 UTSW 7 30524412 missense probably damaging 0.99
R6485:Arhgap33 UTSW 7 30524004 missense probably benign
R6572:Arhgap33 UTSW 7 30527210 missense probably damaging 1.00
R7183:Arhgap33 UTSW 7 30525871 splice site probably null
R7205:Arhgap33 UTSW 7 30533009 missense probably damaging 0.99
R7241:Arhgap33 UTSW 7 30528721 missense probably damaging 1.00
R7259:Arhgap33 UTSW 7 30532200 missense probably damaging 1.00
R7319:Arhgap33 UTSW 7 30526369 missense probably benign
R7384:Arhgap33 UTSW 7 30527271 missense probably damaging 1.00
R7412:Arhgap33 UTSW 7 30523052 missense probably benign 0.00
R7693:Arhgap33 UTSW 7 30526112 critical splice donor site probably null
R7747:Arhgap33 UTSW 7 30524135 missense probably damaging 0.98
R7893:Arhgap33 UTSW 7 30528776 missense probably benign 0.34
R7915:Arhgap33 UTSW 7 30523223 missense probably benign 0.08
R8819:Arhgap33 UTSW 7 30528740 missense probably benign 0.09
R8820:Arhgap33 UTSW 7 30528740 missense probably benign 0.09
R8912:Arhgap33 UTSW 7 30533042 splice site probably benign
R8922:Arhgap33 UTSW 7 30523992 missense probably damaging 0.99
R9211:Arhgap33 UTSW 7 30523598 missense possibly damaging 0.94
X0034:Arhgap33 UTSW 7 30524449 small deletion probably benign
Z1176:Arhgap33 UTSW 7 30522717 missense probably benign 0.13
Z1177:Arhgap33 UTSW 7 30522817 missense probably damaging 1.00
Z1186:Arhgap33 UTSW 7 30523651 missense possibly damaging 0.72
Z1186:Arhgap33 UTSW 7 30524435 missense probably benign
Z1186:Arhgap33 UTSW 7 30524479 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GAAATCGTCATAGCTCCGGAG -3'
(R):5'- GGTTCTGATAGGCTCTGCTC -3'

Sequencing Primer
(F):5'- GAGGACTGGCCAGGAGC -3'
(R):5'- ATAGGCTCTGCTCTGTGACAAGAC -3'
Posted On 2016-04-27