Mutagenetix > Incidental Mutations

Incidental Mutation 'R4957:Arhgap33'

381650

Institutional Source

Beutler Lab

Gene Symbol

Arhgap33

Ensembl Gene

ENSMUSG00000036882

Gene Name

Rho GTPase activating protein 33

Synonyms

Snx26, NOMA-GAP, Tcgap

MMRRC Submission

042554-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R4957 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30522226-30535060 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30532361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 101 (G101R)

Ref Sequence

ENSEMBL: ENSMUSP00000147001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208491] [ENSMUST00000208522] [ENSMUST00000208538]

AlphaFold

Q80YF9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044338
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882
AA Change: G101R

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
SH3	213	271	5.32e-12	SMART
low complexity region	318	335	N/A	INTRINSIC
RhoGAP	350	531	4.05e-67	SMART
low complexity region	582	595	N/A	INTRINSIC
low complexity region	597	609	N/A	INTRINSIC
low complexity region	675	686	N/A	INTRINSIC
low complexity region	694	733	N/A	INTRINSIC
low complexity region	770	798	N/A	INTRINSIC
low complexity region	832	850	N/A	INTRINSIC
low complexity region	894	940	N/A	INTRINSIC
low complexity region	979	988	N/A	INTRINSIC
low complexity region	1076	1086	N/A	INTRINSIC
low complexity region	1158	1166	N/A	INTRINSIC
low complexity region	1194	1216	N/A	INTRINSIC
low complexity region	1284	1291	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207637

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207858
AA Change: G77R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207860
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208491
AA Change: G101R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000208522

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208538
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208723

Meta Mutation Damage Score

0.0817

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Clptm1l	T	A	13: 73,611,196	I245N	possibly damaging	Het
Clptm1l	T	C	13: 73,612,428	I310T	probably damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Crebbp	T	C	16: 4,117,367	Q460R	probably benign	Het
Dnah17	A	T	11: 118,074,298	I2306N	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mme	T	A	3: 63,343,489		probably benign	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Ybx1	A	T	4: 119,278,938		probably benign	Het
Zfp39	T	A	11: 58,891,231	Y235F	possibly damaging	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Arhgap33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Arhgap33	APN	7	30529946	missense	probably damaging	0.99
IGL02176:Arhgap33	APN	7	30524051	missense	possibly damaging	0.76
IGL02430:Arhgap33	APN	7	30522760	missense	probably benign	0.07
IGL03091:Arhgap33	APN	7	30528293	missense	probably damaging	1.00
R0276:Arhgap33	UTSW	7	30523244	missense	probably benign	0.01
R0494:Arhgap33	UTSW	7	30524496	missense	probably damaging	0.98
R0597:Arhgap33	UTSW	7	30526446	missense	probably damaging	1.00
R0717:Arhgap33	UTSW	7	30528349	missense	probably damaging	1.00
R1661:Arhgap33	UTSW	7	30532323	missense	probably damaging	1.00
R1761:Arhgap33	UTSW	7	30533063	splice site	probably null
R1882:Arhgap33	UTSW	7	30522809	missense	probably damaging	1.00
R2161:Arhgap33	UTSW	7	30528650	splice site	probably null
R2566:Arhgap33	UTSW	7	30527229	missense	probably damaging	1.00
R4353:Arhgap33	UTSW	7	30524136	missense	possibly damaging	0.95
R4552:Arhgap33	UTSW	7	30519108	unclassified	probably benign
R4778:Arhgap33	UTSW	7	30532093	missense	probably benign
R4887:Arhgap33	UTSW	7	30532192	missense	probably damaging	0.99
R5001:Arhgap33	UTSW	7	30533016	missense	possibly damaging	0.95
R5140:Arhgap33	UTSW	7	30528301	missense	probably damaging	1.00
R5585:Arhgap33	UTSW	7	30523835	missense	probably benign	0.00
R5704:Arhgap33	UTSW	7	30519620	unclassified	probably benign
R5805:Arhgap33	UTSW	7	30526414	missense	probably benign	0.01
R6476:Arhgap33	UTSW	7	30524412	missense	probably damaging	0.99
R6485:Arhgap33	UTSW	7	30524004	missense	probably benign
R6572:Arhgap33	UTSW	7	30527210	missense	probably damaging	1.00
R7183:Arhgap33	UTSW	7	30525871	splice site	probably null
R7205:Arhgap33	UTSW	7	30533009	missense	probably damaging	0.99
R7241:Arhgap33	UTSW	7	30528721	missense	probably damaging	1.00
R7259:Arhgap33	UTSW	7	30532200	missense	probably damaging	1.00
R7319:Arhgap33	UTSW	7	30526369	missense	probably benign
R7384:Arhgap33	UTSW	7	30527271	missense	probably damaging	1.00
R7412:Arhgap33	UTSW	7	30523052	missense	probably benign	0.00
R7693:Arhgap33	UTSW	7	30526112	critical splice donor site	probably null
R7747:Arhgap33	UTSW	7	30524135	missense	probably damaging	0.98
R7893:Arhgap33	UTSW	7	30528776	missense	probably benign	0.34
R7915:Arhgap33	UTSW	7	30523223	missense	probably benign	0.08
R8819:Arhgap33	UTSW	7	30528740	missense	probably benign	0.09
R8820:Arhgap33	UTSW	7	30528740	missense	probably benign	0.09
R8912:Arhgap33	UTSW	7	30533042	splice site	probably benign
R8922:Arhgap33	UTSW	7	30523992	missense	probably damaging	0.99
R9211:Arhgap33	UTSW	7	30523598	missense	possibly damaging	0.94
X0034:Arhgap33	UTSW	7	30524449	small deletion	probably benign
Z1176:Arhgap33	UTSW	7	30522717	missense	probably benign	0.13
Z1177:Arhgap33	UTSW	7	30522817	missense	probably damaging	1.00
Z1186:Arhgap33	UTSW	7	30523651	missense	possibly damaging	0.72
Z1186:Arhgap33	UTSW	7	30524435	missense	probably benign
Z1186:Arhgap33	UTSW	7	30524479	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAATCGTCATAGCTCCGGAG -3'
(R):5'- GGTTCTGATAGGCTCTGCTC -3'

Sequencing Primer
(F):5'- GAGGACTGGCCAGGAGC -3'
(R):5'- ATAGGCTCTGCTCTGTGACAAGAC -3'

Posted On

2016-04-27