Incidental Mutation 'R4957:Arhgap33'
ID 381650
Institutional Source Beutler Lab
Gene Symbol Arhgap33
Ensembl Gene ENSMUSG00000036882
Gene Name Rho GTPase activating protein 33
Synonyms Snx26, Tcgap, NOMA-GAP
MMRRC Submission 042554-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30221651-30234485 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30231786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 101 (G101R)
Ref Sequence ENSEMBL: ENSMUSP00000147001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208491] [ENSMUST00000208522] [ENSMUST00000208538]
AlphaFold Q80YF9
Predicted Effect possibly damaging
Transcript: ENSMUST00000044338
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882
AA Change: G101R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
SH3 213 271 5.32e-12 SMART
low complexity region 318 335 N/A INTRINSIC
RhoGAP 350 531 4.05e-67 SMART
low complexity region 582 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 694 733 N/A INTRINSIC
low complexity region 770 798 N/A INTRINSIC
low complexity region 832 850 N/A INTRINSIC
low complexity region 894 940 N/A INTRINSIC
low complexity region 979 988 N/A INTRINSIC
low complexity region 1076 1086 N/A INTRINSIC
low complexity region 1158 1166 N/A INTRINSIC
low complexity region 1194 1216 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207637
Predicted Effect possibly damaging
Transcript: ENSMUST00000207858
AA Change: G77R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207860
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000208491
AA Change: G101R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000208522
Predicted Effect possibly damaging
Transcript: ENSMUST00000208538
AA Change: G101R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208723
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,096,840 (GRCm39) probably benign Het
3110009E18Rik C T 1: 120,096,850 (GRCm39) probably benign Het
3110009E18Rik G T 1: 120,096,849 (GRCm39) probably benign Het
6820408C15Rik T A 2: 152,286,013 (GRCm39) V342D probably damaging Het
Atf7ip C T 6: 136,583,808 (GRCm39) R1280C probably damaging Het
Cacnb4 T C 2: 52,448,303 (GRCm39) H8R probably damaging Het
Ccdc150 T A 1: 54,404,027 (GRCm39) probably benign Het
Cd74 A G 18: 60,942,109 (GRCm39) N113D probably benign Het
Cdc25b T C 2: 131,035,525 (GRCm39) V341A possibly damaging Het
Clptm1l T A 13: 73,759,315 (GRCm39) I245N possibly damaging Het
Clptm1l T C 13: 73,760,547 (GRCm39) I310T probably damaging Het
Creb5 A T 6: 53,670,907 (GRCm39) probably null Het
Crebbp T C 16: 3,935,231 (GRCm39) Q460R probably benign Het
Dnah17 A T 11: 117,965,124 (GRCm39) I2306N probably benign Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Elovl1 A T 4: 118,289,120 (GRCm39) H215L probably damaging Het
Enkd1 A G 8: 106,431,121 (GRCm39) I202T probably benign Het
Epha7 C T 4: 28,871,892 (GRCm39) A407V probably damaging Het
Ercc3 G T 18: 32,376,170 (GRCm39) G130W probably damaging Het
Fbxl8 A G 8: 105,994,827 (GRCm39) E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 (GRCm39) N339K probably damaging Het
Frrs1 G A 3: 116,678,897 (GRCm39) D240N probably benign Het
Gemin2 A G 12: 59,063,954 (GRCm39) S105G probably benign Het
Glra1 T A 11: 55,418,224 (GRCm39) I257F probably damaging Het
Gmcl1 G A 6: 86,687,503 (GRCm39) P354S probably damaging Het
Gpr15 G T 16: 58,538,537 (GRCm39) A184E probably damaging Het
Grm7 G A 6: 111,335,824 (GRCm39) G745E probably damaging Het
H2-T10 T A 17: 36,428,308 (GRCm39) probably benign Het
Hdac5 C A 11: 102,096,082 (GRCm39) probably benign Het
Ift22 G A 5: 136,937,070 (GRCm39) probably benign Het
Ighg3 T C 12: 113,324,750 (GRCm39) E34G unknown Het
Itga11 A T 9: 62,674,930 (GRCm39) T821S probably benign Het
Lmod2 T C 6: 24,603,871 (GRCm39) V282A possibly damaging Het
Maml2 A G 9: 13,531,572 (GRCm39) K262R probably damaging Het
Mme T A 3: 63,250,910 (GRCm39) probably benign Het
Mnat1 A G 12: 73,170,652 (GRCm39) Y14C probably damaging Het
Mtdh A T 15: 34,083,281 (GRCm39) T34S possibly damaging Het
Ncaph T C 2: 126,963,177 (GRCm39) D352G possibly damaging Het
Or2t43 A G 11: 58,457,344 (GRCm39) Y276H probably damaging Het
Or4f17-ps1 C A 2: 111,358,569 (GRCm39) N321K probably benign Het
Or5m9b T A 2: 85,905,854 (GRCm39) Y257N probably damaging Het
Or9g8 T C 2: 85,607,459 (GRCm39) F177S probably damaging Het
Pcdhb13 T A 18: 37,577,837 (GRCm39) D738E possibly damaging Het
Pla2g4f C T 2: 120,130,980 (GRCm39) R825Q probably benign Het
Pnliprp2 C T 19: 58,763,577 (GRCm39) L409F possibly damaging Het
Prlr G T 15: 10,319,281 (GRCm39) C70F probably damaging Het
Ptpn14 C T 1: 189,583,469 (GRCm39) T772I probably benign Het
Ryr2 T C 13: 11,799,966 (GRCm39) Q927R probably damaging Het
Scarf1 A G 11: 75,416,460 (GRCm39) E634G probably benign Het
Scart1 T C 7: 139,808,435 (GRCm39) V782A probably damaging Het
Skic3 T G 13: 76,333,232 (GRCm39) probably null Het
Slc39a14 A T 14: 70,553,260 (GRCm39) S158R probably damaging Het
Slc9c1 A T 16: 45,365,194 (GRCm39) T176S probably benign Het
Srsf10 T C 4: 135,583,541 (GRCm39) S2P probably damaging Het
Tcam1 T A 11: 106,173,705 (GRCm39) C50S probably damaging Het
Tcf7l2 A G 19: 55,919,864 (GRCm39) probably null Het
Tdrd3 T A 14: 87,743,223 (GRCm39) H390Q probably benign Het
Tlk2 T C 11: 105,144,185 (GRCm39) probably null Het
Tnc G C 4: 63,894,793 (GRCm39) P1531R probably damaging Het
Tnfrsf1b C A 4: 144,973,327 (GRCm39) Q15H probably damaging Het
Tnfrsf1b T G 4: 144,973,328 (GRCm39) Q15P possibly damaging Het
Tssk4 A T 14: 55,889,266 (GRCm39) E264V probably damaging Het
Ugt3a1 G A 15: 9,365,274 (GRCm39) V296I probably benign Het
Usp5 C G 6: 124,799,593 (GRCm39) K318N possibly damaging Het
Vmn2r8 T G 5: 108,947,129 (GRCm39) E541A probably benign Het
Ybx1 A T 4: 119,136,135 (GRCm39) probably benign Het
Zfp39 T A 11: 58,782,057 (GRCm39) Y235F possibly damaging Het
Zfp422 T A 6: 116,603,904 (GRCm39) K32* probably null Het
Zpbp2 T A 11: 98,442,150 (GRCm39) probably null Het
Other mutations in Arhgap33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Arhgap33 APN 7 30,229,371 (GRCm39) missense probably damaging 0.99
IGL02176:Arhgap33 APN 7 30,223,476 (GRCm39) missense possibly damaging 0.76
IGL02430:Arhgap33 APN 7 30,222,185 (GRCm39) missense probably benign 0.07
IGL03091:Arhgap33 APN 7 30,227,718 (GRCm39) missense probably damaging 1.00
R0276:Arhgap33 UTSW 7 30,222,669 (GRCm39) missense probably benign 0.01
R0494:Arhgap33 UTSW 7 30,223,921 (GRCm39) missense probably damaging 0.98
R0597:Arhgap33 UTSW 7 30,225,871 (GRCm39) missense probably damaging 1.00
R0717:Arhgap33 UTSW 7 30,227,774 (GRCm39) missense probably damaging 1.00
R1661:Arhgap33 UTSW 7 30,231,748 (GRCm39) missense probably damaging 1.00
R1761:Arhgap33 UTSW 7 30,232,488 (GRCm39) splice site probably null
R1882:Arhgap33 UTSW 7 30,222,234 (GRCm39) missense probably damaging 1.00
R2161:Arhgap33 UTSW 7 30,228,075 (GRCm39) splice site probably null
R2566:Arhgap33 UTSW 7 30,226,654 (GRCm39) missense probably damaging 1.00
R4353:Arhgap33 UTSW 7 30,223,561 (GRCm39) missense possibly damaging 0.95
R4552:Arhgap33 UTSW 7 30,218,533 (GRCm39) unclassified probably benign
R4778:Arhgap33 UTSW 7 30,231,518 (GRCm39) missense probably benign
R4887:Arhgap33 UTSW 7 30,231,617 (GRCm39) missense probably damaging 0.99
R5001:Arhgap33 UTSW 7 30,232,441 (GRCm39) missense possibly damaging 0.95
R5140:Arhgap33 UTSW 7 30,227,726 (GRCm39) missense probably damaging 1.00
R5585:Arhgap33 UTSW 7 30,223,260 (GRCm39) missense probably benign 0.00
R5704:Arhgap33 UTSW 7 30,219,045 (GRCm39) unclassified probably benign
R5805:Arhgap33 UTSW 7 30,225,839 (GRCm39) missense probably benign 0.01
R6476:Arhgap33 UTSW 7 30,223,837 (GRCm39) missense probably damaging 0.99
R6485:Arhgap33 UTSW 7 30,223,429 (GRCm39) missense probably benign
R6572:Arhgap33 UTSW 7 30,226,635 (GRCm39) missense probably damaging 1.00
R7183:Arhgap33 UTSW 7 30,225,296 (GRCm39) splice site probably null
R7205:Arhgap33 UTSW 7 30,232,434 (GRCm39) missense probably damaging 0.99
R7241:Arhgap33 UTSW 7 30,228,146 (GRCm39) missense probably damaging 1.00
R7259:Arhgap33 UTSW 7 30,231,625 (GRCm39) missense probably damaging 1.00
R7319:Arhgap33 UTSW 7 30,225,794 (GRCm39) missense probably benign
R7384:Arhgap33 UTSW 7 30,226,696 (GRCm39) missense probably damaging 1.00
R7412:Arhgap33 UTSW 7 30,222,477 (GRCm39) missense probably benign 0.00
R7693:Arhgap33 UTSW 7 30,225,537 (GRCm39) critical splice donor site probably null
R7747:Arhgap33 UTSW 7 30,223,560 (GRCm39) missense probably damaging 0.98
R7893:Arhgap33 UTSW 7 30,228,201 (GRCm39) missense probably benign 0.34
R7915:Arhgap33 UTSW 7 30,222,648 (GRCm39) missense probably benign 0.08
R8819:Arhgap33 UTSW 7 30,228,165 (GRCm39) missense probably benign 0.09
R8820:Arhgap33 UTSW 7 30,228,165 (GRCm39) missense probably benign 0.09
R8912:Arhgap33 UTSW 7 30,232,467 (GRCm39) splice site probably benign
R8922:Arhgap33 UTSW 7 30,223,417 (GRCm39) missense probably damaging 0.99
R9211:Arhgap33 UTSW 7 30,223,023 (GRCm39) missense possibly damaging 0.94
R9616:Arhgap33 UTSW 7 30,229,367 (GRCm39) missense probably damaging 0.99
R9755:Arhgap33 UTSW 7 30,227,926 (GRCm39) missense possibly damaging 0.91
R9762:Arhgap33 UTSW 7 30,230,950 (GRCm39) missense probably null 1.00
X0034:Arhgap33 UTSW 7 30,223,874 (GRCm39) small deletion probably benign
Z1176:Arhgap33 UTSW 7 30,222,142 (GRCm39) missense probably benign 0.13
Z1177:Arhgap33 UTSW 7 30,222,242 (GRCm39) missense probably damaging 1.00
Z1186:Arhgap33 UTSW 7 30,223,904 (GRCm39) small insertion probably benign
Z1186:Arhgap33 UTSW 7 30,223,860 (GRCm39) missense probably benign
Z1186:Arhgap33 UTSW 7 30,223,076 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAAATCGTCATAGCTCCGGAG -3'
(R):5'- GGTTCTGATAGGCTCTGCTC -3'

Sequencing Primer
(F):5'- GAGGACTGGCCAGGAGC -3'
(R):5'- ATAGGCTCTGCTCTGTGACAAGAC -3'
Posted On 2016-04-27