Mutagenetix > Incidental Mutations

Incidental Mutation 'R4957:Zfp39'

381658

Institutional Source

Beutler Lab

Gene Symbol

Zfp39

Ensembl Gene

ENSMUSG00000037001

Gene Name

zinc finger protein 39

Synonyms

Zfp-39, CTfin33

MMRRC Submission

042554-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.164) question?

Stock #

R4957 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58888153-58904225 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58891231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 235 (Y235F)

Ref Sequence

ENSEMBL: ENSMUSP00000099764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102703]

AlphaFold

Q02525

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102703
AA Change: Y235F

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: Y235F

Domain	Start	End	E-Value	Type
KRAB	59	119	8.23e-34	SMART
low complexity region	171	180	N/A	INTRINSIC
ZnF_C2H2	298	320	9.58e-3	SMART
ZnF_C2H2	326	347	2.2e2	SMART
ZnF_C2H2	353	373	1.18e2	SMART
ZnF_C2H2	409	431	8.34e-3	SMART
ZnF_C2H2	437	459	7.26e-3	SMART
ZnF_C2H2	465	487	1.53e-1	SMART
ZnF_C2H2	493	515	9.08e-4	SMART
ZnF_C2H2	521	543	2.61e-4	SMART
ZnF_C2H2	549	571	1.12e-3	SMART
ZnF_C2H2	577	599	4.94e-5	SMART
ZnF_C2H2	605	627	5.14e-3	SMART
ZnF_C2H2	633	655	1.38e-3	SMART
ZnF_C2H2	661	683	6.78e-3	SMART
ZnF_C2H2	689	711	5.14e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132394

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Arhgap33	C	T	7: 30,532,361	G101R	probably damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Clptm1l	T	A	13: 73,611,196	I245N	possibly damaging	Het
Clptm1l	T	C	13: 73,612,428	I310T	probably damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Crebbp	T	C	16: 4,117,367	Q460R	probably benign	Het
Dnah17	A	T	11: 118,074,298	I2306N	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mme	T	A	3: 63,343,489		probably benign	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Ybx1	A	T	4: 119,278,938		probably benign	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Zfp39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Zfp39	APN	11	58893059	splice site	probably benign
IGL01597:Zfp39	APN	11	58891543	missense	probably damaging	0.96
IGL02055:Zfp39	APN	11	58891330	missense	probably benign
IGL02456:Zfp39	APN	11	58902800	nonsense	probably null
IGL02873:Zfp39	APN	11	58891022	missense	probably benign	0.12
H8562:Zfp39	UTSW	11	58900686	missense	probably damaging	1.00
R0462:Zfp39	UTSW	11	58890406	missense	probably benign	0.03
R0513:Zfp39	UTSW	11	58889987	missense	probably benign	0.09
R1185:Zfp39	UTSW	11	58902844	missense	possibly damaging	0.91
R1185:Zfp39	UTSW	11	58902844	missense	possibly damaging	0.91
R1185:Zfp39	UTSW	11	58902844	missense	possibly damaging	0.91
R1401:Zfp39	UTSW	11	58890323	missense	probably benign	0.01
R1797:Zfp39	UTSW	11	58900660	missense	probably damaging	0.96
R2146:Zfp39	UTSW	11	58890332	missense	probably benign	0.05
R3903:Zfp39	UTSW	11	58890175	missense	probably benign	0.44
R4303:Zfp39	UTSW	11	58890017	missense	probably damaging	1.00
R4706:Zfp39	UTSW	11	58902807	missense	probably benign	0.41
R5092:Zfp39	UTSW	11	58891202	missense	possibly damaging	0.71
R5158:Zfp39	UTSW	11	58889845	missense	possibly damaging	0.81
R5292:Zfp39	UTSW	11	58900589	missense	probably damaging	0.97
R5697:Zfp39	UTSW	11	58889835	missense	probably benign	0.08
R5906:Zfp39	UTSW	11	58902891	missense	probably benign
R5925:Zfp39	UTSW	11	58891273	missense	possibly damaging	0.94
R6174:Zfp39	UTSW	11	58891387	missense	probably benign	0.01
R6177:Zfp39	UTSW	11	58891061	missense	probably benign	0.27
R6968:Zfp39	UTSW	11	58891480	missense	probably benign	0.00
R7045:Zfp39	UTSW	11	58890443	missense	unknown
R7139:Zfp39	UTSW	11	58890559	missense	probably damaging	1.00
R7421:Zfp39	UTSW	11	58890107	missense	probably damaging	1.00
R7493:Zfp39	UTSW	11	58891043	missense	possibly damaging	0.82
R7689:Zfp39	UTSW	11	58890643	missense	probably damaging	1.00
R8061:Zfp39	UTSW	11	58902747	missense	probably benign
R8136:Zfp39	UTSW	11	58891402	missense	probably damaging	0.99
R8955:Zfp39	UTSW	11	58890120	nonsense	probably null
Z1186:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1186:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1186:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1186:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1186:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1186:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1186:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1186:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1186:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1186:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1186:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1186:Zfp39	UTSW	11	58891297	missense	probably benign
Z1186:Zfp39	UTSW	11	58891316	missense	probably benign
Z1186:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1186:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1187:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1187:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1187:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1187:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1187:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1187:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1187:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1187:Zfp39	UTSW	11	58890886	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1187:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1187:Zfp39	UTSW	11	58891297	missense	probably benign
Z1187:Zfp39	UTSW	11	58891316	missense	probably benign
Z1187:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1187:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1188:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1188:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1188:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1188:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1188:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1188:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1188:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1188:Zfp39	UTSW	11	58890886	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1188:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1188:Zfp39	UTSW	11	58891297	missense	probably benign
Z1188:Zfp39	UTSW	11	58891316	missense	probably benign
Z1188:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1188:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1189:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1189:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1189:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1189:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1189:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1189:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1189:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1189:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1189:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1189:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1189:Zfp39	UTSW	11	58891297	missense	probably benign
Z1189:Zfp39	UTSW	11	58891316	missense	probably benign
Z1189:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1189:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1190:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1190:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1190:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1190:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1190:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1190:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1190:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1190:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1190:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1190:Zfp39	UTSW	11	58891297	missense	probably benign
Z1190:Zfp39	UTSW	11	58891316	missense	probably benign
Z1190:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1190:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1191:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1191:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1191:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1191:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1191:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1191:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1191:Zfp39	UTSW	11	58890876	missense	probably damaging	0.97
Z1191:Zfp39	UTSW	11	58890886	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1191:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1191:Zfp39	UTSW	11	58891297	missense	probably benign
Z1191:Zfp39	UTSW	11	58891316	missense	probably benign
Z1191:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1191:Zfp39	UTSW	11	58900583	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58890045	nonsense	probably null
Z1192:Zfp39	UTSW	11	58890047	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58890304	missense	possibly damaging	0.91
Z1192:Zfp39	UTSW	11	58890447	missense	probably benign	0.16
Z1192:Zfp39	UTSW	11	58890448	missense	possibly damaging	0.86
Z1192:Zfp39	UTSW	11	58890700	missense	possibly damaging	0.50
Z1192:Zfp39	UTSW	11	58890771	missense	probably benign	0.00
Z1192:Zfp39	UTSW	11	58890779	missense	probably benign	0.09
Z1192:Zfp39	UTSW	11	58890898	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58890925	missense	probably benign	0.29
Z1192:Zfp39	UTSW	11	58891141	missense	probably damaging	0.99
Z1192:Zfp39	UTSW	11	58891297	missense	probably benign
Z1192:Zfp39	UTSW	11	58891316	missense	probably benign
Z1192:Zfp39	UTSW	11	58900581	missense	probably benign	0.01
Z1192:Zfp39	UTSW	11	58900583	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCACGTCTTGGGCATGAAG -3'
(R):5'- AGACATCTGTGGCACCATGC -3'

Sequencing Primer
(F):5'- TTGGGCATGAAGAGCTACCTCATC -3'
(R):5'- ATGTGAGCTCAAACTGTGTTTC -3'

Posted On

2016-04-27