Incidental Mutation 'R4957:Zfp39'
ID 381658
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Name zinc finger protein 39
Synonyms Zfp-39, CTfin33
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 58888153-58904225 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58891231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 235 (Y235F)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
AlphaFold Q02525
Predicted Effect possibly damaging
Transcript: ENSMUST00000102703
AA Change: Y235F

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: Y235F

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132394
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58893059 splice site probably benign
IGL01597:Zfp39 APN 11 58891543 missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58891330 missense probably benign
IGL02456:Zfp39 APN 11 58902800 nonsense probably null
IGL02873:Zfp39 APN 11 58891022 missense probably benign 0.12
H8562:Zfp39 UTSW 11 58900686 missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58890406 missense probably benign 0.03
R0513:Zfp39 UTSW 11 58889987 missense probably benign 0.09
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58890323 missense probably benign 0.01
R1797:Zfp39 UTSW 11 58900660 missense probably damaging 0.96
R2146:Zfp39 UTSW 11 58890332 missense probably benign 0.05
R3903:Zfp39 UTSW 11 58890175 missense probably benign 0.44
R4303:Zfp39 UTSW 11 58890017 missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58902807 missense probably benign 0.41
R5092:Zfp39 UTSW 11 58891202 missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58889845 missense possibly damaging 0.81
R5292:Zfp39 UTSW 11 58900589 missense probably damaging 0.97
R5697:Zfp39 UTSW 11 58889835 missense probably benign 0.08
R5906:Zfp39 UTSW 11 58902891 missense probably benign
R5925:Zfp39 UTSW 11 58891273 missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58891387 missense probably benign 0.01
R6177:Zfp39 UTSW 11 58891061 missense probably benign 0.27
R6968:Zfp39 UTSW 11 58891480 missense probably benign 0.00
R7045:Zfp39 UTSW 11 58890443 missense unknown
R7139:Zfp39 UTSW 11 58890559 missense probably damaging 1.00
R7421:Zfp39 UTSW 11 58890107 missense probably damaging 1.00
R7493:Zfp39 UTSW 11 58891043 missense possibly damaging 0.82
R7689:Zfp39 UTSW 11 58890643 missense probably damaging 1.00
R8061:Zfp39 UTSW 11 58902747 missense probably benign
R8136:Zfp39 UTSW 11 58891402 missense probably damaging 0.99
R8955:Zfp39 UTSW 11 58890120 nonsense probably null
Z1186:Zfp39 UTSW 11 58890045 nonsense probably null
Z1186:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1186:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1186:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1186:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1186:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1186:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1186:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1186:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58891297 missense probably benign
Z1186:Zfp39 UTSW 11 58891316 missense probably benign
Z1186:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890045 nonsense probably null
Z1187:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1187:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1187:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1187:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1187:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1187:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1187:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1187:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1187:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1187:Zfp39 UTSW 11 58891297 missense probably benign
Z1187:Zfp39 UTSW 11 58891316 missense probably benign
Z1187:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890045 nonsense probably null
Z1188:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1188:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1188:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1188:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1188:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1188:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1188:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1188:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1188:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1188:Zfp39 UTSW 11 58891297 missense probably benign
Z1188:Zfp39 UTSW 11 58891316 missense probably benign
Z1188:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890045 nonsense probably null
Z1189:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1189:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1189:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1189:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1189:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1189:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1189:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1189:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1189:Zfp39 UTSW 11 58891297 missense probably benign
Z1189:Zfp39 UTSW 11 58891316 missense probably benign
Z1189:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890045 nonsense probably null
Z1190:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1190:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1190:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1190:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1190:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1190:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1190:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1190:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1190:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1190:Zfp39 UTSW 11 58891297 missense probably benign
Z1190:Zfp39 UTSW 11 58891316 missense probably benign
Z1190:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890045 nonsense probably null
Z1191:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1191:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1191:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1191:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1191:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1191:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1191:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1191:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1191:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1191:Zfp39 UTSW 11 58891297 missense probably benign
Z1191:Zfp39 UTSW 11 58891316 missense probably benign
Z1191:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890045 nonsense probably null
Z1192:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1192:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1192:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1192:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1192:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1192:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1192:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1192:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1192:Zfp39 UTSW 11 58891297 missense probably benign
Z1192:Zfp39 UTSW 11 58891316 missense probably benign
Z1192:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACGTCTTGGGCATGAAG -3'
(R):5'- AGACATCTGTGGCACCATGC -3'

Sequencing Primer
(F):5'- TTGGGCATGAAGAGCTACCTCATC -3'
(R):5'- ATGTGAGCTCAAACTGTGTTTC -3'
Posted On 2016-04-27