Incidental Mutation 'R4957:Scarf1'
ID 381659
Institutional Source Beutler Lab
Gene Symbol Scarf1
Ensembl Gene ENSMUSG00000038188
Gene Name scavenger receptor class F, member 1
Synonyms SREC-I, SREC
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 75513540-75526582 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75525634 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 634 (E634G)
Ref Sequence ENSEMBL: ENSMUSP00000044248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042808] [ENSMUST00000118243] [ENSMUST00000123819]
AlphaFold Q5ND28
Predicted Effect probably benign
Transcript: ENSMUST00000042808
AA Change: E634G

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188
AA Change: E634G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209836
Meta Mutation Damage Score 0.0937 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scavenger receptor that is expressed in endothelial cells. It regulates the uptake of chemically modified low density lipoproteins, including acetylated low density lipoprotein (Ac-LDL), and it may be involved in atherogenesis. This gene is regulated by the transcription factors ZNF444/EZF-2 and SP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no abnormalities detected in plasma glucose, cholesterol, or triglycerides, or in the brain, lung, heart, kidney, liver, or testes. Mice homozygous for a targeted allele exhibit impaired clearance of apoptotic cells and autoimmune disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Scarf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scarf1 APN 11 75521957 missense probably damaging 0.98
IGL02968:Scarf1 APN 11 75524089 missense probably damaging 1.00
R0078:Scarf1 UTSW 11 75515162 splice site probably benign
R0606:Scarf1 UTSW 11 75514348 missense probably damaging 0.98
R0834:Scarf1 UTSW 11 75514403 nonsense probably null
R1715:Scarf1 UTSW 11 75524044 missense probably damaging 1.00
R2327:Scarf1 UTSW 11 75526028 missense probably damaging 1.00
R2483:Scarf1 UTSW 11 75515291 missense probably damaging 0.98
R3699:Scarf1 UTSW 11 75514369 missense probably damaging 1.00
R3831:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3832:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3833:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R4990:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R4992:Scarf1 UTSW 11 75522230 missense probably damaging 1.00
R4992:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R5291:Scarf1 UTSW 11 75524074 missense probably damaging 1.00
R5330:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5331:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5537:Scarf1 UTSW 11 75525531 missense probably damaging 1.00
R5583:Scarf1 UTSW 11 75514016 missense possibly damaging 0.95
R5592:Scarf1 UTSW 11 75525687 missense probably benign 0.08
R6130:Scarf1 UTSW 11 75525739 missense probably benign
R6289:Scarf1 UTSW 11 75525416 missense possibly damaging 0.83
R6313:Scarf1 UTSW 11 75520315 missense probably benign 0.02
R6360:Scarf1 UTSW 11 75515669 missense probably damaging 1.00
R6944:Scarf1 UTSW 11 75522206 missense probably benign 0.00
R7113:Scarf1 UTSW 11 75526078 missense probably damaging 0.99
R7624:Scarf1 UTSW 11 75514416 splice site probably null
R8191:Scarf1 UTSW 11 75522239 missense probably benign 0.01
R8258:Scarf1 UTSW 11 75523863 missense probably damaging 0.97
R8259:Scarf1 UTSW 11 75523863 missense probably damaging 0.97
R8433:Scarf1 UTSW 11 75521032 critical splice donor site probably null
R9003:Scarf1 UTSW 11 75515243 missense possibly damaging 0.46
R9233:Scarf1 UTSW 11 75525894 missense probably benign
R9292:Scarf1 UTSW 11 75515180 missense probably damaging 1.00
R9345:Scarf1 UTSW 11 75513575 utr 5 prime probably benign
Z1088:Scarf1 UTSW 11 75525490 missense probably damaging 1.00
Z1177:Scarf1 UTSW 11 75515247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGCCTCCACACCATTC -3'
(R):5'- TCAGGTTTCTGAGGTGTCCC -3'

Sequencing Primer
(F):5'- ACCATTCCCCATTCCACGTAC -3'
(R):5'- GTGTCCCTGCCAGCATATAGATAG -3'
Posted On 2016-04-27