Mutagenetix > Incidental Mutations

Incidental Mutation 'R4957:Dnah17'

381663

Institutional Source

Beutler Lab

Gene Symbol

Dnah17

Ensembl Gene

ENSMUSG00000033987

Gene Name

dynein, axonemal, heavy chain 17

Synonyms

LOC382552, Dnahcl1, 2810003K23Rik, Dnahc17

MMRRC Submission

042554-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4957 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118021723-118130634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118074298 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 2306 (I2306N)

Ref Sequence

ENSEMBL: ENSMUSP00000081864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]

Predicted Effect

probably benign
Transcript: ENSMUST00000084803
AA Change: I2306N

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: I2306N

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	183	766	8.5e-142	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1260	1673	5.8e-135	PFAM
Pfam:AAA_6	1793	2023	6e-161	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	7.8e-13	PFAM
Pfam:AAA_7	2400	2671	1.1e-171	PFAM
Pfam:AAA_8	2748	3015	4.9e-166	PFAM
Pfam:MT	3027	3370	3.4e-214	PFAM
Pfam:AAA_9	3388	3615	2.4e-144	PFAM
Pfam:Dynein_heavy	3742	4452	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106308
AA Change: I2306N

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: I2306N

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	184	764	1.7e-152	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1262	1671	4.1e-132	PFAM
Pfam:AAA_6	1793	2023	7e-149	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	2.5e-11	PFAM
Pfam:AAA_7	2400	2671	4.4e-169	PFAM
Pfam:AAA_8	2748	3015	7.1e-163	PFAM
Pfam:MT	3027	3370	1.1e-210	PFAM
Pfam:AAA_9	3392	3614	1e-84	PFAM
Pfam:Dynein_heavy	3748	4479	3.5e-230	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132685
AA Change: I2319N

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: I2319N

Domain	Start	End	E-Value	Type
Pfam:DHC_N2	279	688	3.1e-132	PFAM
Pfam:AAA_6	811	1041	5.3e-149	PFAM
low complexity region	1110	1122	N/A	INTRINSIC
Blast:AAA	1123	1354	1e-104	BLAST
Pfam:AAA_7	1452	1671	8.9e-134	PFAM
Pfam:AAA_8	1763	2030	5.4e-163	PFAM
Pfam:MT	2042	2168	6.8e-52	PFAM
Pfam:MT	2163	2412	8.2e-149	PFAM
Pfam:AAA_9	2434	2656	7.9e-85	PFAM
Pfam:Dynein_heavy	2790	3457	2.6e-209	PFAM
Pfam:Dynein_heavy	3460	3569	4.6e-17	PFAM

Meta Mutation Damage Score

0.1585

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Arhgap33	C	T	7: 30,532,361	G101R	probably damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Clptm1l	T	A	13: 73,611,196	I245N	possibly damaging	Het
Clptm1l	T	C	13: 73,612,428	I310T	probably damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Crebbp	T	C	16: 4,117,367	Q460R	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mme	T	A	3: 63,343,489		probably benign	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Ybx1	A	T	4: 119,278,938		probably benign	Het
Zfp39	T	A	11: 58,891,231	Y235F	possibly damaging	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Dnah17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Dnah17	APN	11	118088214	missense	possibly damaging	0.81
IGL00531:Dnah17	APN	11	118043173	missense	probably damaging	0.97
IGL00764:Dnah17	APN	11	118096485	missense	probably damaging	0.99
IGL00795:Dnah17	APN	11	118093634	missense	probably benign	0.35
IGL00823:Dnah17	APN	11	118047161	missense	probably benign	0.22
IGL01145:Dnah17	APN	11	118047173	missense	possibly damaging	0.63
IGL01433:Dnah17	APN	11	118049934	missense	probably damaging	1.00
IGL01454:Dnah17	APN	11	118058397	missense	probably damaging	1.00
IGL01545:Dnah17	APN	11	118119568	missense	probably damaging	1.00
IGL01548:Dnah17	APN	11	118098612	missense	probably benign	0.21
IGL01557:Dnah17	APN	11	118073686	missense	probably damaging	0.98
IGL01632:Dnah17	APN	11	118033881	missense	probably damaging	1.00
IGL01636:Dnah17	APN	11	118041056	missense	probably benign	0.03
IGL01672:Dnah17	APN	11	118042160	missense	probably damaging	0.97
IGL01822:Dnah17	APN	11	118081993	missense	probably damaging	1.00
IGL01869:Dnah17	APN	11	118052676	missense	probably benign	0.09
IGL01916:Dnah17	APN	11	118125288	missense	probably benign	0.00
IGL02131:Dnah17	APN	11	118072908	missense	probably damaging	1.00
IGL02154:Dnah17	APN	11	118124261	missense	probably benign	0.01
IGL02220:Dnah17	APN	11	118072967	nonsense	probably null
IGL02454:Dnah17	APN	11	118080767	missense	probably damaging	0.98
IGL02458:Dnah17	APN	11	118036350	missense	probably damaging	1.00
IGL02588:Dnah17	APN	11	118025653	missense	possibly damaging	0.95
IGL02865:Dnah17	APN	11	118073548	missense	probably damaging	1.00
IGL02881:Dnah17	APN	11	118042118	missense	probably damaging	1.00
IGL02952:Dnah17	APN	11	118088268	missense	probably benign	0.03
IGL03382:Dnah17	APN	11	118081943	missense	probably damaging	1.00
IGL03389:Dnah17	APN	11	118094979	missense	probably damaging	1.00
ergos	UTSW	11	118041158	splice site	probably benign
watt	UTSW	11	118080766	missense	probably damaging	0.96
PIT4280001:Dnah17	UTSW	11	118098582	missense	possibly damaging	0.85
R0004:Dnah17	UTSW	11	118060092	missense	possibly damaging	0.90
R0112:Dnah17	UTSW	11	118074434	missense	possibly damaging	0.82
R0116:Dnah17	UTSW	11	118058306	missense	probably benign	0.01
R0157:Dnah17	UTSW	11	118127171	missense	probably benign
R0320:Dnah17	UTSW	11	118052674	missense	possibly damaging	0.56
R0362:Dnah17	UTSW	11	118098539	missense	probably benign	0.10
R0382:Dnah17	UTSW	11	118128996	missense	probably damaging	1.00
R0383:Dnah17	UTSW	11	118067547	missense	probably benign
R0400:Dnah17	UTSW	11	118082078	missense	probably damaging	1.00
R0420:Dnah17	UTSW	11	118039939	missense	probably damaging	1.00
R0483:Dnah17	UTSW	11	118047124	missense	probably benign
R0533:Dnah17	UTSW	11	118110537	missense	possibly damaging	0.50
R0562:Dnah17	UTSW	11	118072900	missense	probably damaging	1.00
R0564:Dnah17	UTSW	11	118082981	missense	probably damaging	1.00
R0604:Dnah17	UTSW	11	118121471	missense	probably benign	0.00
R0608:Dnah17	UTSW	11	118090749	nonsense	probably null
R0614:Dnah17	UTSW	11	118070568	splice site	probably benign
R0632:Dnah17	UTSW	11	118067682	splice site	probably benign
R0831:Dnah17	UTSW	11	118060271	missense	probably damaging	0.99
R0838:Dnah17	UTSW	11	118060104	missense	probably damaging	1.00
R0879:Dnah17	UTSW	11	118056835	splice site	probably benign
R1061:Dnah17	UTSW	11	118052688	missense	possibly damaging	0.51
R1190:Dnah17	UTSW	11	118042175	missense	probably damaging	1.00
R1293:Dnah17	UTSW	11	118127137	critical splice donor site	probably null
R1297:Dnah17	UTSW	11	118121366	splice site	probably benign
R1332:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1336:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1364:Dnah17	UTSW	11	118125606	splice site	probably benign
R1418:Dnah17	UTSW	11	118074023	missense	probably damaging	0.98
R1432:Dnah17	UTSW	11	118023327	missense	probably damaging	1.00
R1497:Dnah17	UTSW	11	118114233	missense	probably damaging	1.00
R1500:Dnah17	UTSW	11	118101053	missense	probably benign
R1506:Dnah17	UTSW	11	118125387	missense	possibly damaging	0.53
R1512:Dnah17	UTSW	11	118095015	missense	probably benign
R1567:Dnah17	UTSW	11	118125985	missense	probably damaging	1.00
R1597:Dnah17	UTSW	11	118103498	splice site	probably benign
R1665:Dnah17	UTSW	11	118121495	splice site	probably benign
R1703:Dnah17	UTSW	11	118026749	missense	probably damaging	1.00
R1716:Dnah17	UTSW	11	118032598	missense	probably benign	0.00
R1727:Dnah17	UTSW	11	118070489	missense	probably damaging	0.98
R1727:Dnah17	UTSW	11	118096536	nonsense	probably null
R1728:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1784:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1852:Dnah17	UTSW	11	118121916	missense	probably damaging	0.97
R1869:Dnah17	UTSW	11	118047189	nonsense	probably null
R1886:Dnah17	UTSW	11	118108161	missense	possibly damaging	0.62
R1893:Dnah17	UTSW	11	118066968	missense	probably benign	0.00
R1954:Dnah17	UTSW	11	118024731	missense	probably damaging	1.00
R1969:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1971:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1975:Dnah17	UTSW	11	118096536	nonsense	probably null
R1977:Dnah17	UTSW	11	118112591	missense	possibly damaging	0.52
R2055:Dnah17	UTSW	11	118067531	missense	probably benign	0.00
R2115:Dnah17	UTSW	11	118119802	missense	probably benign	0.00
R2132:Dnah17	UTSW	11	118033747	missense	probably damaging	0.98
R2200:Dnah17	UTSW	11	118102409	splice site	probably benign
R2277:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2279:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2400:Dnah17	UTSW	11	118126384	critical splice acceptor site	probably null
R2402:Dnah17	UTSW	11	118125974	missense	probably benign	0.10
R2497:Dnah17	UTSW	11	118087024	synonymous	probably null
R2923:Dnah17	UTSW	11	118093547	missense	probably damaging	1.00
R3121:Dnah17	UTSW	11	118041086	missense	probably damaging	1.00
R3236:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3237:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3498:Dnah17	UTSW	11	118080849	splice site	probably benign
R3499:Dnah17	UTSW	11	118080849	splice site	probably benign
R3746:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3749:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3762:Dnah17	UTSW	11	118104526	missense	probably benign	0.00
R3826:Dnah17	UTSW	11	118041158	splice site	probably benign
R3828:Dnah17	UTSW	11	118041158	splice site	probably benign
R3829:Dnah17	UTSW	11	118041158	splice site	probably benign
R3877:Dnah17	UTSW	11	118024707	missense	probably damaging	1.00
R3899:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3900:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3911:Dnah17	UTSW	11	118080849	splice site	probably benign
R3913:Dnah17	UTSW	11	118080849	splice site	probably benign
R3930:Dnah17	UTSW	11	118080849	splice site	probably benign
R3931:Dnah17	UTSW	11	118080849	splice site	probably benign
R3969:Dnah17	UTSW	11	118041158	splice site	probably benign
R3970:Dnah17	UTSW	11	118041158	splice site	probably benign
R4056:Dnah17	UTSW	11	118070538	missense	probably benign	0.05
R4113:Dnah17	UTSW	11	118112594	missense	possibly damaging	0.50
R4295:Dnah17	UTSW	11	118118772	missense	probably damaging	1.00
R4324:Dnah17	UTSW	11	118094213	missense	probably benign	0.01
R4412:Dnah17	UTSW	11	118073683	missense	probably damaging	1.00
R4413:Dnah17	UTSW	11	118025168	missense	probably benign	0.00
R4422:Dnah17	UTSW	11	118081973	missense	possibly damaging	0.91
R4552:Dnah17	UTSW	11	118052943	missense	possibly damaging	0.79
R4669:Dnah17	UTSW	11	118074293	missense	probably benign	0.02
R4677:Dnah17	UTSW	11	118119814	missense	probably damaging	1.00
R4716:Dnah17	UTSW	11	118073648	missense	probably benign	0.02
R4832:Dnah17	UTSW	11	118026780	missense	probably damaging	1.00
R4868:Dnah17	UTSW	11	118108212	missense	probably benign	0.03
R4897:Dnah17	UTSW	11	118078593	missense	probably damaging	1.00
R4928:Dnah17	UTSW	11	118027433	missense	probably damaging	1.00
R4937:Dnah17	UTSW	11	118042154	missense	probably damaging	1.00
R5008:Dnah17	UTSW	11	118110577	missense	probably benign	0.01
R5016:Dnah17	UTSW	11	118080766	missense	probably damaging	0.96
R5027:Dnah17	UTSW	11	118102539	missense	probably benign	0.01
R5133:Dnah17	UTSW	11	118117113	missense	probably benign	0.00
R5140:Dnah17	UTSW	11	118086945	missense	probably damaging	1.00
R5146:Dnah17	UTSW	11	118114179	missense	probably damaging	0.99
R5151:Dnah17	UTSW	11	118027467	missense	probably damaging	1.00
R5153:Dnah17	UTSW	11	118082974	nonsense	probably null
R5192:Dnah17	UTSW	11	118034359	missense	possibly damaging	0.96
R5315:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5317:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5335:Dnah17	UTSW	11	118112514	missense	probably damaging	1.00
R5379:Dnah17	UTSW	11	118117203	intron	probably benign
R5396:Dnah17	UTSW	11	118127282	missense	probably benign
R5418:Dnah17	UTSW	11	118094984	missense	probably benign	0.04
R5534:Dnah17	UTSW	11	118052770	missense	possibly damaging	0.83
R5539:Dnah17	UTSW	11	118073660	missense	probably benign	0.03
R5594:Dnah17	UTSW	11	118043229	splice site	probably null
R5634:Dnah17	UTSW	11	118052926	splice site	probably null
R5696:Dnah17	UTSW	11	118101056	missense	probably benign	0.44
R5802:Dnah17	UTSW	11	118036446	missense	possibly damaging	0.79
R5826:Dnah17	UTSW	11	118034367	missense	probably damaging	1.00
R5873:Dnah17	UTSW	11	118056897	missense	probably benign	0.01
R5898:Dnah17	UTSW	11	118114213	missense	probably benign	0.00
R5934:Dnah17	UTSW	11	118041102	missense	probably benign
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6113:Dnah17	UTSW	11	118126275	missense	probably damaging	1.00
R6117:Dnah17	UTSW	11	118119571	missense	probably benign	0.00
R6137:Dnah17	UTSW	11	118025654	missense	probably damaging	1.00
R6173:Dnah17	UTSW	11	118039946	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126323	nonsense	probably null
R6258:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126323	nonsense	probably null
R6260:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6278:Dnah17	UTSW	11	118126290	missense	probably damaging	0.99
R6298:Dnah17	UTSW	11	118108161	missense	probably benign	0.00
R6300:Dnah17	UTSW	11	118034310	missense	probably damaging	1.00
R6302:Dnah17	UTSW	11	118129155	missense	probably benign	0.09
R6363:Dnah17	UTSW	11	118110505	missense	probably benign
R6381:Dnah17	UTSW	11	118129185	missense	probably benign	0.08
R6418:Dnah17	UTSW	11	118129197	missense	probably damaging	0.99
R6660:Dnah17	UTSW	11	118100188	missense	probably benign
R6803:Dnah17	UTSW	11	118125372	missense	probably benign	0.00
R6820:Dnah17	UTSW	11	118069000	missense	probably damaging	0.99
R6885:Dnah17	UTSW	11	118090772	missense	possibly damaging	0.47
R6921:Dnah17	UTSW	11	118041484	missense	probably damaging	0.98
R6932:Dnah17	UTSW	11	118060079	missense	possibly damaging	0.95
R6954:Dnah17	UTSW	11	118066432	missense	probably damaging	1.00
R7000:Dnah17	UTSW	11	118025702	critical splice acceptor site	probably null
R7007:Dnah17	UTSW	11	118118871	missense	possibly damaging	0.92
R7048:Dnah17	UTSW	11	118046118	missense	possibly damaging	0.80
R7056:Dnah17	UTSW	11	118125386	missense	probably benign
R7131:Dnah17	UTSW	11	118079658	missense	probably benign	0.14
R7143:Dnah17	UTSW	11	118086130	missense	probably damaging	1.00
R7146:Dnah17	UTSW	11	118082110	missense	probably damaging	0.98
R7147:Dnah17	UTSW	11	118094929	missense	probably benign	0.31
R7172:Dnah17	UTSW	11	118041131	nonsense	probably null
R7183:Dnah17	UTSW	11	118129188	missense	probably benign
R7297:Dnah17	UTSW	11	118055730	critical splice donor site	probably null
R7297:Dnah17	UTSW	11	118103356	missense	probably damaging	0.98
R7367:Dnah17	UTSW	11	118115196	missense	probably benign
R7398:Dnah17	UTSW	11	118080724	missense	probably damaging	0.96
R7426:Dnah17	UTSW	11	118090717	missense	probably null	0.79
R7524:Dnah17	UTSW	11	118121481	missense	probably benign	0.03
R7529:Dnah17	UTSW	11	118049866	critical splice donor site	probably null
R7615:Dnah17	UTSW	11	118110547	nonsense	probably null
R7681:Dnah17	UTSW	11	118025186	missense	probably damaging	1.00
R7702:Dnah17	UTSW	11	118025640	missense	probably benign	0.00
R7702:Dnah17	UTSW	11	118121478	missense	possibly damaging	0.64
R7713:Dnah17	UTSW	11	118025171	missense	probably benign	0.02
X0058:Dnah17	UTSW	11	118082925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTTGCTGAACTCCACTCG -3'
(R):5'- GACTGACCGTCGGCCATC -3'

Sequencing Primer
(F):5'- TCCACTCGATAATCAATGAGCTG -3'
(R):5'- GGCCATCCCTCCCTCCAG -3'

Posted On

2016-04-27