Mutagenetix > Incidental Mutation

Incidental Mutation 'R4957:Clptm1l'

381669

Institutional Source

Beutler Lab

Gene Symbol

Clptm1l

Ensembl Gene

ENSMUSG00000021610

Gene Name

CLPTM1-like

Synonyms

C130052I12Rik

MMRRC Submission

042554-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4957 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73604006-73620605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73612428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 310 (I310T)

Ref Sequence

ENSEMBL: ENSMUSP00000022102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022102]

AlphaFold

Q8BXA5

Predicted Effect

probably damaging
Transcript: ENSMUST00000022102
AA Change: I310T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: I310T

Domain	Start	End	E-Value	Type
Pfam:CLPTM1	10	423	3.2e-134	PFAM
transmembrane domain	428	450	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222343

Meta Mutation Damage Score

0.9461

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Arhgap33	C	T	7: 30,532,361	G101R	probably damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Crebbp	T	C	16: 4,117,367	Q460R	probably benign	Het
Dnah17	A	T	11: 118,074,298	I2306N	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mme	T	A	3: 63,343,489		probably benign	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Ybx1	A	T	4: 119,278,938		probably benign	Het
Zfp39	T	A	11: 58,891,231	Y235F	possibly damaging	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Clptm1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01672:Clptm1l	APN	13	73607873	splice site	probably null
IGL01963:Clptm1l	APN	13	73617569	splice site	probably benign
IGL02169:Clptm1l	APN	13	73611663	missense	probably damaging	0.96
IGL02554:Clptm1l	APN	13	73607760	missense	probably benign	0.07
IGL02596:Clptm1l	APN	13	73613666	missense	probably benign	0.02
IGL02720:Clptm1l	APN	13	73614602	splice site	probably benign
IGL03100:Clptm1l	APN	13	73612390	splice site	probably benign
P0023:Clptm1l	UTSW	13	73604952	missense	possibly damaging	0.67
R0308:Clptm1l	UTSW	13	73611667	missense	possibly damaging	0.67
R0725:Clptm1l	UTSW	13	73606343	missense	probably benign
R1572:Clptm1l	UTSW	13	73607747	missense	probably benign
R1589:Clptm1l	UTSW	13	73614673	critical splice donor site	probably null
R2062:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2064:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2065:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2067:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2068:Clptm1l	UTSW	13	73607723	nonsense	probably null
R3003:Clptm1l	UTSW	13	73617756	missense	possibly damaging	0.51
R3712:Clptm1l	UTSW	13	73616038	missense	probably benign	0.21
R3808:Clptm1l	UTSW	13	73612454	missense	probably benign	0.13
R3966:Clptm1l	UTSW	13	73615972	missense	probably damaging	1.00
R4615:Clptm1l	UTSW	13	73607738	nonsense	probably null
R4801:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4802:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4957:Clptm1l	UTSW	13	73611196	missense	possibly damaging	0.52
R5864:Clptm1l	UTSW	13	73606284	missense	probably damaging	0.99
R6502:Clptm1l	UTSW	13	73617765	critical splice donor site	probably null
R6701:Clptm1l	UTSW	13	73608906	missense	probably benign	0.00
R6720:Clptm1l	UTSW	13	73618516	missense	probably damaging	1.00
R7782:Clptm1l	UTSW	13	73604320	missense	probably damaging	1.00
R8292:Clptm1l	UTSW	13	73617735	missense	probably damaging	0.96
R8329:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R9224:Clptm1l	UTSW	13	73604225	start gained	probably benign
R9528:Clptm1l	UTSW	13	73612431	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AAGTGGTGGGTTCCGTAGAC -3'
(R):5'- CTCAGTGAGATTCAGAGATGCTC -3'

Sequencing Primer
(F):5'- GTTCCGTAGACAGTGAACATGTC -3'
(R):5'- GATTCAGAGATGCTCACTGACTGC -3'

Posted On

2016-04-27