Incidental Mutation 'R4957:Slc39a14'
ID 381672
Institutional Source Beutler Lab
Gene Symbol Slc39a14
Ensembl Gene ENSMUSG00000022094
Gene Name solute carrier family 39 (zinc transporter), member 14
Synonyms Zip14, G630015O18Rik
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70303469-70351425 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70315811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 158 (S158R)
Ref Sequence ENSEMBL: ENSMUSP00000117010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022688] [ENSMUST00000068044] [ENSMUST00000127000] [ENSMUST00000139284] [ENSMUST00000143153] [ENSMUST00000151011] [ENSMUST00000152067] [ENSMUST00000152442]
AlphaFold Q75N73
Predicted Effect possibly damaging
Transcript: ENSMUST00000022688
AA Change: S158R

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022688
Gene: ENSMUSG00000022094
AA Change: S158R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 4.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068044
SMART Domains Protein: ENSMUSP00000066108
Gene: ENSMUSG00000022094

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 5.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127000
SMART Domains Protein: ENSMUSP00000117792
Gene: ENSMUSG00000022094

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139284
SMART Domains Protein: ENSMUSP00000122615
Gene: ENSMUSG00000022094

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146453
Predicted Effect probably benign
Transcript: ENSMUST00000151011
SMART Domains Protein: ENSMUSP00000118319
Gene: ENSMUSG00000022094

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152067
AA Change: S158R

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119040
Gene: ENSMUSG00000022094
AA Change: S158R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 3.3e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152202
Predicted Effect probably damaging
Transcript: ENSMUST00000152442
AA Change: S158R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117010
Gene: ENSMUSG00000022094
AA Change: S158R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155825
Meta Mutation Damage Score 0.4361 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A14 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, scoliosis, osteopenia, short long bones, altered gluconeogenesis and chondrocyte differentiation, low plasma IGF-I and liver zinc levels. Homozygotes for another null allele show reduced liver zinc levels and hepatocyte proliferation after hepatectomy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Slc39a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Slc39a14 APN 14 70306685 missense possibly damaging 0.91
IGL02348:Slc39a14 APN 14 70316436 critical splice donor site probably null
IGL03108:Slc39a14 APN 14 70318919 missense probably damaging 0.98
IGL03391:Slc39a14 APN 14 70309842 missense probably damaging 1.00
R1741:Slc39a14 UTSW 14 70318744 missense probably damaging 1.00
R2437:Slc39a14 UTSW 14 70316436 critical splice donor site probably null
R4726:Slc39a14 UTSW 14 70313599 critical splice donor site probably null
R4808:Slc39a14 UTSW 14 70315801 missense probably damaging 1.00
R4911:Slc39a14 UTSW 14 70309922 missense probably benign 0.00
R5815:Slc39a14 UTSW 14 70306745 missense probably damaging 1.00
R6393:Slc39a14 UTSW 14 70309813 missense probably benign 0.02
R6464:Slc39a14 UTSW 14 70306728 missense probably damaging 0.98
R6466:Slc39a14 UTSW 14 70309886 missense probably damaging 1.00
R6757:Slc39a14 UTSW 14 70310884 missense probably damaging 1.00
R6969:Slc39a14 UTSW 14 70308826 missense probably damaging 0.99
R7569:Slc39a14 UTSW 14 70309827 missense possibly damaging 0.66
R7711:Slc39a14 UTSW 14 70313675 missense probably damaging 1.00
R7830:Slc39a14 UTSW 14 70310117 missense probably benign 0.00
R8075:Slc39a14 UTSW 14 70308798 missense possibly damaging 0.87
R9171:Slc39a14 UTSW 14 70310238 missense probably benign 0.01
R9371:Slc39a14 UTSW 14 70310120 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCCCAGGAAAAGTGAAC -3'
(R):5'- ACCATGTTGCGTCTCCAGTC -3'

Sequencing Primer
(F):5'- AACGCGCGCCTGTTCTAC -3'
(R):5'- TCCTCTAAAGGGTAAGCTGCTCAG -3'
Posted On 2016-04-27