Incidental Mutation 'R4957:Mtdh'
ID 381676
Institutional Source Beutler Lab
Gene Symbol Mtdh
Ensembl Gene ENSMUSG00000022255
Gene Name metadherin
Synonyms 3D3/Lyric, 2610103J23Rik, D8Bwg1112e, AEG-1, Lyric
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4957 (G1)
Quality Score 221
Status Validated
Chromosome 15
Chromosomal Location 34082694-34145624 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34083135 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 34 (T34S)
Ref Sequence ENSEMBL: ENSMUSP00000129500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022865] [ENSMUST00000168991]
AlphaFold Q80WJ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000022865
AA Change: T34S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022865
Gene: ENSMUSG00000022255
AA Change: T34S

DomainStartEndE-ValueType
Pfam:LYRIC 6 420 1e-143 PFAM
low complexity region 438 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163333
SMART Domains Protein: ENSMUSP00000130190
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 4 256 2.3e-70 PFAM
Pfam:LYRIC 250 297 4.4e-13 PFAM
low complexity region 315 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163697
Predicted Effect possibly damaging
Transcript: ENSMUST00000168991
AA Change: T34S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129500
Gene: ENSMUSG00000022255
AA Change: T34S

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
low complexity region 111 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170050
SMART Domains Protein: ENSMUSP00000128288
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 3 304 4.2e-90 PFAM
low complexity region 322 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170553
SMART Domains Protein: ENSMUSP00000126167
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 3 106 7.7e-28 PFAM
Pfam:LYRIC 99 220 3.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172083
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with decreased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Mtdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Mtdh APN 15 34083109 missense probably damaging 1.00
IGL01772:Mtdh APN 15 34139881 missense probably damaging 1.00
IGL02153:Mtdh APN 15 34131250 missense possibly damaging 0.93
IGL02392:Mtdh APN 15 34099577 missense probably damaging 0.98
IGL03052:Mtdh UTSW 15 34140730 missense possibly damaging 0.53
R0062:Mtdh UTSW 15 34134280 splice site probably benign
R0333:Mtdh UTSW 15 34118101 missense possibly damaging 0.86
R0791:Mtdh UTSW 15 34116382 splice site probably benign
R1472:Mtdh UTSW 15 34114045 missense possibly damaging 0.86
R1713:Mtdh UTSW 15 34114839 missense possibly damaging 0.86
R3605:Mtdh UTSW 15 34114112 splice site probably benign
R4626:Mtdh UTSW 15 34114834 nonsense probably null
R5196:Mtdh UTSW 15 34118004 missense probably damaging 0.99
R5977:Mtdh UTSW 15 34099574 missense probably damaging 0.99
R6491:Mtdh UTSW 15 34116327 missense probably damaging 1.00
R6852:Mtdh UTSW 15 34136721 missense probably damaging 0.96
R7049:Mtdh UTSW 15 34131165 missense probably damaging 0.97
R7899:Mtdh UTSW 15 34123719 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTCCAAGACTAGAGTCCGC -3'
(R):5'- ATTCTTCAGCTGGGCTAGGTC -3'

Sequencing Primer
(F):5'- TATCCCCTACTCCGGCGTGAG -3'
(R):5'- CTGGGCTAGGTCGTCGG -3'
Posted On 2016-04-27