Mutagenetix > Incidental Mutations

Incidental Mutation 'R4957:Crebbp'

381677

Institutional Source

Beutler Lab

Gene Symbol

Crebbp

Ensembl Gene

ENSMUSG00000022521

Gene Name

CREB binding protein

Synonyms

KAT3A, CBP

MMRRC Submission

042554-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4957 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

4081328-4213997 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4117367 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 460 (Q460R)

Ref Sequence

ENSEMBL: ENSMUSP00000146029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205344] [ENSMUST00000205765]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023165
AA Change: Q924R

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: Q924R

Domain	Start	End	E-Value	Type
low complexity region	47	58	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	95	105	N/A	INTRINSIC
low complexity region	213	233	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
ZnF_TAZ	347	432	2.31e-32	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:KIX	586	666	1.4e-42	PFAM
low complexity region	874	893	N/A	INTRINSIC
low complexity region	909	958	N/A	INTRINSIC
low complexity region	1045	1065	N/A	INTRINSIC
BROMO	1085	1195	4.26e-43	SMART
Blast:KAT11	1265	1308	3e-15	BLAST
KAT11	1343	1649	4.25e-137	SMART
ZnF_ZZ	1702	1743	2.17e-15	SMART
ZnF_TAZ	1767	1845	6.8e-30	SMART
low complexity region	1847	1877	N/A	INTRINSIC
low complexity region	1884	1914	N/A	INTRINSIC
low complexity region	1942	1971	N/A	INTRINSIC
Pfam:Creb_binding	2019	2115	8.2e-38	PFAM
low complexity region	2147	2161	N/A	INTRINSIC
low complexity region	2197	2216	N/A	INTRINSIC
low complexity region	2260	2279	N/A	INTRINSIC
low complexity region	2286	2304	N/A	INTRINSIC
low complexity region	2343	2378	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205344
AA Change: Q460R

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000205685

Predicted Effect

probably benign
Transcript: ENSMUST00000205765
AA Change: Q886R

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
6820408C15Rik	T	A	2: 152,444,093	V342D	probably damaging	Het
Arhgap33	C	T	7: 30,532,361	G101R	probably damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Cacnb4	T	C	2: 52,558,291	H8R	probably damaging	Het
Ccdc150	T	A	1: 54,364,868		probably benign	Het
Cd163l1	T	C	7: 140,228,522	V782A	probably damaging	Het
Cd74	A	G	18: 60,809,037	N113D	probably benign	Het
Cdc25b	T	C	2: 131,193,605	V341A	possibly damaging	Het
Clptm1l	T	A	13: 73,611,196	I245N	possibly damaging	Het
Clptm1l	T	C	13: 73,612,428	I310T	probably damaging	Het
Creb5	A	T	6: 53,693,922		probably null	Het
Dnah17	A	T	11: 118,074,298	I2306N	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Elovl1	A	T	4: 118,431,923	H215L	probably damaging	Het
Enkd1	A	G	8: 105,704,489	I202T	probably benign	Het
Epha7	C	T	4: 28,871,892	A407V	probably damaging	Het
Ercc3	G	T	18: 32,243,117	G130W	probably damaging	Het
Fbxl8	A	G	8: 105,268,195	E113G	probably damaging	Het
Frmpd1	T	G	4: 45,273,099	N339K	probably damaging	Het
Frrs1	G	A	3: 116,885,248	D240N	probably benign	Het
Gemin2	A	G	12: 59,017,168	S105G	probably benign	Het
Glra1	T	A	11: 55,527,398	I257F	probably damaging	Het
Gmcl1	G	A	6: 86,710,521	P354S	probably damaging	Het
Gpr15	G	T	16: 58,718,174	A184E	probably damaging	Het
Grm7	G	A	6: 111,358,863	G745E	probably damaging	Het
H2-T10	T	A	17: 36,117,416		probably benign	Het
Hdac5	C	A	11: 102,205,256		probably benign	Het
Ift22	G	A	5: 136,908,216		probably benign	Het
Ighg3	T	C	12: 113,361,130	E34G	unknown	Het
Itga11	A	T	9: 62,767,648	T821S	probably benign	Het
Lmod2	T	C	6: 24,603,872	V282A	possibly damaging	Het
Maml2	A	G	9: 13,620,276	K262R	probably damaging	Het
Mme	T	A	3: 63,343,489		probably benign	Het
Mnat1	A	G	12: 73,123,878	Y14C	probably damaging	Het
Mtdh	A	T	15: 34,083,135	T34S	possibly damaging	Het
Ncaph	T	C	2: 127,121,257	D352G	possibly damaging	Het
Olfr1014	T	C	2: 85,777,115	F177S	probably damaging	Het
Olfr1036	T	A	2: 86,075,510	Y257N	probably damaging	Het
Olfr1293-ps	C	A	2: 111,528,224	N321K	probably benign	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Pcdhb13	T	A	18: 37,444,784	D738E	possibly damaging	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Pnliprp2	C	T	19: 58,775,145	L409F	possibly damaging	Het
Prlr	G	T	15: 10,319,195	C70F	probably damaging	Het
Ptpn14	C	T	1: 189,851,272	T772I	probably benign	Het
Ryr2	T	C	13: 11,785,080	Q927R	probably damaging	Het
Scarf1	A	G	11: 75,525,634	E634G	probably benign	Het
Slc39a14	A	T	14: 70,315,811	S158R	probably damaging	Het
Slc9c1	A	T	16: 45,544,831	T176S	probably benign	Het
Srsf10	T	C	4: 135,856,230	S2P	probably damaging	Het
Tcam1	T	A	11: 106,282,879	C50S	probably damaging	Het
Tcf7l2	A	G	19: 55,931,432		probably null	Het
Tdrd3	T	A	14: 87,505,787	H390Q	probably benign	Het
Tlk2	T	C	11: 105,253,359		probably null	Het
Tnc	G	C	4: 63,976,556	P1531R	probably damaging	Het
Tnfrsf1b	C	A	4: 145,246,757	Q15H	probably damaging	Het
Tnfrsf1b	T	G	4: 145,246,758	Q15P	possibly damaging	Het
Tssk4	A	T	14: 55,651,809	E264V	probably damaging	Het
Ttc37	T	G	13: 76,185,113		probably null	Het
Ugt3a2	G	A	15: 9,365,188	V296I	probably benign	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r8	T	G	5: 108,799,263	E541A	probably benign	Het
Ybx1	A	T	4: 119,278,938		probably benign	Het
Zfp39	T	A	11: 58,891,231	Y235F	possibly damaging	Het
Zfp422	T	A	6: 116,626,943	K32*	probably null	Het
Zpbp2	T	A	11: 98,551,324		probably null	Het

Other mutations in Crebbp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Crebbp	APN	16	4179552	missense	probably benign
IGL01366:Crebbp	APN	16	4126506	missense	probably damaging	1.00
IGL01457:Crebbp	APN	16	4124768	missense	probably damaging	0.99
IGL01713:Crebbp	APN	16	4128648	missense	possibly damaging	0.79
IGL02382:Crebbp	APN	16	4108070	missense	probably damaging	1.00
IGL02513:Crebbp	APN	16	4126605	splice site	probably null
IGL02519:Crebbp	APN	16	4101593	missense	possibly damaging	0.80
IGL02533:Crebbp	APN	16	4107432	missense	probably damaging	1.00
IGL02582:Crebbp	APN	16	4084277	missense	possibly damaging	0.87
IGL02600:Crebbp	APN	16	4155018	missense	probably benign
IGL02716:Crebbp	APN	16	4114878	missense	probably benign	0.22
IGL02736:Crebbp	APN	16	4154910	missense	probably benign	0.00
IGL03349:Crebbp	APN	16	4117358	missense	possibly damaging	0.69
Intriguing	UTSW	16	4180022	missense	possibly damaging	0.83
R8964_crebbp_645	UTSW	16	4091889	missense	probably damaging	1.00
Suggestive	UTSW	16	4108127	missense	probably damaging	1.00
PIT4418001:Crebbp	UTSW	16	4114825	missense	probably benign	0.02
R0022:Crebbp	UTSW	16	4085228	missense	probably damaging	1.00
R0029:Crebbp	UTSW	16	4117443	missense	probably damaging	1.00
R0098:Crebbp	UTSW	16	4091928	missense	probably damaging	1.00
R0098:Crebbp	UTSW	16	4091928	missense	probably damaging	1.00
R0125:Crebbp	UTSW	16	4117241	splice site	probably benign
R0126:Crebbp	UTSW	16	4084063	missense	possibly damaging	0.94
R0140:Crebbp	UTSW	16	4117499	missense	probably damaging	1.00
R0546:Crebbp	UTSW	16	4085807	missense	probably damaging	0.99
R0705:Crebbp	UTSW	16	4155010	missense	possibly damaging	0.95
R0801:Crebbp	UTSW	16	4088276	missense	probably damaging	1.00
R1103:Crebbp	UTSW	16	4084061	missense	probably damaging	0.97
R1225:Crebbp	UTSW	16	4126956	missense	probably benign	0.04
R1421:Crebbp	UTSW	16	4124647	missense	probably damaging	1.00
R1513:Crebbp	UTSW	16	4115885	missense	probably damaging	1.00
R1531:Crebbp	UTSW	16	4084517	missense	probably benign	0.04
R1860:Crebbp	UTSW	16	4087736	missense	possibly damaging	0.68
R1941:Crebbp	UTSW	16	4179691	missense	probably benign
R1953:Crebbp	UTSW	16	4179449	missense	probably benign	0.23
R1992:Crebbp	UTSW	16	4128697	splice site	probably null
R2000:Crebbp	UTSW	16	4084252	missense	probably damaging	0.98
R2006:Crebbp	UTSW	16	4084753	unclassified	probably benign
R2022:Crebbp	UTSW	16	4085819	missense	probably damaging	1.00
R2044:Crebbp	UTSW	16	4084823	missense	probably benign	0.04
R2185:Crebbp	UTSW	16	4084138	missense	probably damaging	0.99
R2203:Crebbp	UTSW	16	4138777	missense	possibly damaging	0.72
R2349:Crebbp	UTSW	16	4138910	missense	probably damaging	1.00
R2430:Crebbp	UTSW	16	4096465	missense	probably damaging	1.00
R2438:Crebbp	UTSW	16	4154858	missense	possibly damaging	0.90
R2842:Crebbp	UTSW	16	4109198	missense	probably damaging	1.00
R2896:Crebbp	UTSW	16	4138816	missense	probably damaging	1.00
R2920:Crebbp	UTSW	16	4119082	missense	probably damaging	0.98
R3118:Crebbp	UTSW	16	4109198	missense	probably damaging	1.00
R3894:Crebbp	UTSW	16	4096102	missense	probably benign	0.11
R4177:Crebbp	UTSW	16	4119799	missense	possibly damaging	0.48
R4692:Crebbp	UTSW	16	4114863	missense	possibly damaging	0.64
R4790:Crebbp	UTSW	16	4180119	missense	probably damaging	0.98
R4884:Crebbp	UTSW	16	4088375	missense	probably damaging	1.00
R5109:Crebbp	UTSW	16	4088431	intron	probably benign
R5121:Crebbp	UTSW	16	4093511	missense	probably damaging	1.00
R5420:Crebbp	UTSW	16	4107458	missense	probably damaging	1.00
R5455:Crebbp	UTSW	16	4085967	missense	probably benign	0.45
R5485:Crebbp	UTSW	16	4114913	missense	probably benign
R5660:Crebbp	UTSW	16	4154858	missense	possibly damaging	0.90
R5724:Crebbp	UTSW	16	4087635	unclassified	probably benign
R5771:Crebbp	UTSW	16	4119772	missense	probably benign	0.03
R5825:Crebbp	UTSW	16	4087742	missense	probably damaging	0.99
R5919:Crebbp	UTSW	16	4108127	missense	probably damaging	1.00
R5965:Crebbp	UTSW	16	4087661	unclassified	probably benign
R6021:Crebbp	UTSW	16	4085418	missense	probably damaging	1.00
R6146:Crebbp	UTSW	16	4084623	nonsense	probably null
R6521:Crebbp	UTSW	16	4119128	missense	probably damaging	0.99
R6571:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6617:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6618:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6634:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6646:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6647:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6766:Crebbp	UTSW	16	4117500	missense	probably damaging	1.00
R6836:Crebbp	UTSW	16	4180022	missense	possibly damaging	0.83
R7022:Crebbp	UTSW	16	4117323	missense	probably damaging	0.98
R7210:Crebbp	UTSW	16	4084257	missense	possibly damaging	0.95
R7568:Crebbp	UTSW	16	4126489	missense	probably benign	0.34
R7672:Crebbp	UTSW	16	4084710	missense	probably benign	0.06
R8145:Crebbp	UTSW	16	4128525	missense	probably benign	0.03
R8152:Crebbp	UTSW	16	4085081	missense	possibly damaging	0.95
R8374:Crebbp	UTSW	16	4084311	missense	probably damaging	0.99
R8392:Crebbp	UTSW	16	4084281	missense	possibly damaging	0.49
R8679:Crebbp	UTSW	16	4084458	missense	probably damaging	0.99
R8738:Crebbp	UTSW	16	4119088	missense	probably benign	0.07
R8756:Crebbp	UTSW	16	4085903	missense	probably benign	0.01
R8847:Crebbp	UTSW	16	4085027	missense	probably benign	0.01
R8950:Crebbp	UTSW	16	4213159	missense	probably damaging	0.98
R8958:Crebbp	UTSW	16	4213308	start gained	probably benign
R8964:Crebbp	UTSW	16	4091889	missense	probably damaging	1.00
R8972:Crebbp	UTSW	16	4108071	missense	probably benign	0.17
R9069:Crebbp	UTSW	16	4085323	missense	probably benign
R9155:Crebbp	UTSW	16	4096482	missense	probably damaging	1.00
R9240:Crebbp	UTSW	16	4099673	critical splice donor site	probably null
R9414:Crebbp	UTSW	16	4107492	missense	probably damaging	1.00
X0012:Crebbp	UTSW	16	4087765	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGACCATTCTTAAGGGACTCTG -3'
(R):5'- CCTAACCCTCTGAACATGCTGG -3'

Sequencing Primer
(F):5'- CTTAAGGGACTCTGTACAAGTGTGAC -3'
(R):5'- TCTGAACATGCTGGCACCC -3'

Posted On

2016-04-27