Incidental Mutation 'R4957:Pcdhb13'
ID 381685
Institutional Source Beutler Lab
Gene Symbol Pcdhb13
Ensembl Gene ENSMUSG00000047307
Gene Name protocadherin beta 13
Synonyms PcdhbM, Pcdbh6
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R4957 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 37442500-37446209 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37444784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 738 (D738E)
Ref Sequence ENSEMBL: ENSMUSP00000061087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91Y06
Predicted Effect probably benign
Transcript: ENSMUST00000052387
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056915
AA Change: D738E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307
AA Change: D738E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1785 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. Unlike the alpha and gamma clusters, the transcripts from these genes do not share common 3' exons. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell neural connections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cd74 A G 18: 60,809,037 N113D probably benign Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Pcdhb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Pcdhb13 APN 18 37443721 missense possibly damaging 0.56
IGL00718:Pcdhb13 APN 18 37444821 missense possibly damaging 0.91
IGL01143:Pcdhb13 APN 18 37442637 missense probably benign 0.01
IGL01816:Pcdhb13 APN 18 37442975 missense probably benign 0.00
IGL01916:Pcdhb13 APN 18 37443861 missense possibly damaging 0.64
IGL02063:Pcdhb13 APN 18 37444229 missense probably damaging 1.00
IGL02153:Pcdhb13 APN 18 37443685 missense probably damaging 1.00
IGL02332:Pcdhb13 APN 18 37443582 missense probably benign 0.32
IGL02407:Pcdhb13 APN 18 37443075 missense probably damaging 1.00
IGL02423:Pcdhb13 APN 18 37444339 missense possibly damaging 0.95
IGL02514:Pcdhb13 APN 18 37442991 missense possibly damaging 0.80
IGL03025:Pcdhb13 APN 18 37442764 missense probably damaging 1.00
IGL03227:Pcdhb13 APN 18 37443658 missense probably damaging 0.98
IGL03233:Pcdhb13 APN 18 37444265 missense probably damaging 0.96
IGL03239:Pcdhb13 APN 18 37442835 missense probably damaging 0.97
R0046:Pcdhb13 UTSW 18 37444257 missense probably benign
R0172:Pcdhb13 UTSW 18 37442937 missense probably benign 0.00
R0201:Pcdhb13 UTSW 18 37442581 missense probably benign
R0594:Pcdhb13 UTSW 18 37443931 missense probably damaging 1.00
R1235:Pcdhb13 UTSW 18 37444959 makesense probably null
R1292:Pcdhb13 UTSW 18 37443832 missense probably benign 0.43
R1481:Pcdhb13 UTSW 18 37442836 missense probably damaging 1.00
R1991:Pcdhb13 UTSW 18 37443859 missense possibly damaging 0.80
R2058:Pcdhb13 UTSW 18 37444567 missense possibly damaging 0.95
R3508:Pcdhb13 UTSW 18 37443151 missense probably damaging 0.99
R3713:Pcdhb13 UTSW 18 37443733 missense probably damaging 1.00
R4125:Pcdhb13 UTSW 18 37443820 missense probably damaging 1.00
R4741:Pcdhb13 UTSW 18 37443518 missense probably benign 0.01
R4747:Pcdhb13 UTSW 18 37444815 missense probably damaging 0.99
R4973:Pcdhb13 UTSW 18 37443184 missense probably benign 0.20
R5354:Pcdhb13 UTSW 18 37444791 missense probably damaging 1.00
R5364:Pcdhb13 UTSW 18 37443508 missense probably damaging 1.00
R5544:Pcdhb13 UTSW 18 37443520 missense possibly damaging 0.92
R5897:Pcdhb13 UTSW 18 37443211 missense probably benign 0.42
R6174:Pcdhb13 UTSW 18 37443421 missense possibly damaging 0.84
R6702:Pcdhb13 UTSW 18 37444775 missense probably benign 0.42
R6765:Pcdhb13 UTSW 18 37443610 missense probably damaging 1.00
R6960:Pcdhb13 UTSW 18 37443456 missense probably benign 0.45
R7144:Pcdhb13 UTSW 18 37443256 missense probably damaging 1.00
R7225:Pcdhb13 UTSW 18 37444437 missense possibly damaging 0.91
R7239:Pcdhb13 UTSW 18 37444644 missense probably damaging 0.99
R7437:Pcdhb13 UTSW 18 37444675 missense probably damaging 1.00
R7812:Pcdhb13 UTSW 18 37442592 missense probably benign 0.00
R7964:Pcdhb13 UTSW 18 37444818 missense possibly damaging 0.62
R8334:Pcdhb13 UTSW 18 37444800 missense probably damaging 1.00
R8463:Pcdhb13 UTSW 18 37443234 missense possibly damaging 0.94
R8476:Pcdhb13 UTSW 18 37444084 missense probably damaging 1.00
R8501:Pcdhb13 UTSW 18 37444440 missense probably damaging 1.00
R9248:Pcdhb13 UTSW 18 37444555 missense probably damaging 1.00
X0023:Pcdhb13 UTSW 18 37443013 missense probably damaging 1.00
X0028:Pcdhb13 UTSW 18 37444642 missense possibly damaging 0.91
Z1176:Pcdhb13 UTSW 18 37443235 nonsense probably null
Z1177:Pcdhb13 UTSW 18 37442580 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTGAAGATGCGCTCAC -3'
(R):5'- ATCGATAGCGTGCAGATATAGG -3'

Sequencing Primer
(F):5'- GAAGATGCGCTCACGTTATACCTG -3'
(R):5'- ATAGCGTGCAGATATAGGTTAAAAG -3'
Posted On 2016-04-27