Incidental Mutation 'R4957:Cd74'
ID 381686
Institutional Source Beutler Lab
Gene Symbol Cd74
Ensembl Gene ENSMUSG00000024610
Gene Name CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Synonyms Ii, CLIP
MMRRC Submission 042554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R4957 (G1)
Quality Score 216
Status Validated
Chromosome 18
Chromosomal Location 60803848-60812646 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60809037 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 113 (N113D)
Ref Sequence ENSEMBL: ENSMUSP00000126688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050487] [ENSMUST00000097563] [ENSMUST00000167610] [ENSMUST00000175934] [ENSMUST00000176630]
AlphaFold P04441
Predicted Effect probably benign
Transcript: ENSMUST00000050487
AA Change: N113D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057836
Gene: ENSMUSG00000024610
AA Change: N113D

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 2.8e-40 PFAM
Pfam:MHCassoc_trimer 119 190 6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097563
AA Change: N113D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095171
Gene: ENSMUSG00000024610
AA Change: N113D

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 5.3e-40 PFAM
Pfam:MHCassoc_trimer 119 190 6.7e-36 PFAM
TY 212 258 8.6e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167610
AA Change: N113D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000126688
Gene: ENSMUSG00000024610
AA Change: N113D

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 5.8e-45 PFAM
Pfam:MHCassoc_trimer 119 187 1.7e-34 PFAM
TY 212 258 8.6e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175586
Predicted Effect probably benign
Transcript: ENSMUST00000175934
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176630
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired transport of MHC class II molecules, poor antigen presentation, and deficiency of CD4+ T cell development and positive selection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
6820408C15Rik T A 2: 152,444,093 V342D probably damaging Het
Arhgap33 C T 7: 30,532,361 G101R probably damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Cacnb4 T C 2: 52,558,291 H8R probably damaging Het
Ccdc150 T A 1: 54,364,868 probably benign Het
Cd163l1 T C 7: 140,228,522 V782A probably damaging Het
Cdc25b T C 2: 131,193,605 V341A possibly damaging Het
Clptm1l T A 13: 73,611,196 I245N possibly damaging Het
Clptm1l T C 13: 73,612,428 I310T probably damaging Het
Creb5 A T 6: 53,693,922 probably null Het
Crebbp T C 16: 4,117,367 Q460R probably benign Het
Dnah17 A T 11: 118,074,298 I2306N probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Elovl1 A T 4: 118,431,923 H215L probably damaging Het
Enkd1 A G 8: 105,704,489 I202T probably benign Het
Epha7 C T 4: 28,871,892 A407V probably damaging Het
Ercc3 G T 18: 32,243,117 G130W probably damaging Het
Fbxl8 A G 8: 105,268,195 E113G probably damaging Het
Frmpd1 T G 4: 45,273,099 N339K probably damaging Het
Frrs1 G A 3: 116,885,248 D240N probably benign Het
Gemin2 A G 12: 59,017,168 S105G probably benign Het
Glra1 T A 11: 55,527,398 I257F probably damaging Het
Gmcl1 G A 6: 86,710,521 P354S probably damaging Het
Gpr15 G T 16: 58,718,174 A184E probably damaging Het
Grm7 G A 6: 111,358,863 G745E probably damaging Het
H2-T10 T A 17: 36,117,416 probably benign Het
Hdac5 C A 11: 102,205,256 probably benign Het
Ift22 G A 5: 136,908,216 probably benign Het
Ighg3 T C 12: 113,361,130 E34G unknown Het
Itga11 A T 9: 62,767,648 T821S probably benign Het
Lmod2 T C 6: 24,603,872 V282A possibly damaging Het
Maml2 A G 9: 13,620,276 K262R probably damaging Het
Mme T A 3: 63,343,489 probably benign Het
Mnat1 A G 12: 73,123,878 Y14C probably damaging Het
Mtdh A T 15: 34,083,135 T34S possibly damaging Het
Ncaph T C 2: 127,121,257 D352G possibly damaging Het
Olfr1014 T C 2: 85,777,115 F177S probably damaging Het
Olfr1036 T A 2: 86,075,510 Y257N probably damaging Het
Olfr1293-ps C A 2: 111,528,224 N321K probably benign Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Pcdhb13 T A 18: 37,444,784 D738E possibly damaging Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Pnliprp2 C T 19: 58,775,145 L409F possibly damaging Het
Prlr G T 15: 10,319,195 C70F probably damaging Het
Ptpn14 C T 1: 189,851,272 T772I probably benign Het
Ryr2 T C 13: 11,785,080 Q927R probably damaging Het
Scarf1 A G 11: 75,525,634 E634G probably benign Het
Slc39a14 A T 14: 70,315,811 S158R probably damaging Het
Slc9c1 A T 16: 45,544,831 T176S probably benign Het
Srsf10 T C 4: 135,856,230 S2P probably damaging Het
Tcam1 T A 11: 106,282,879 C50S probably damaging Het
Tcf7l2 A G 19: 55,931,432 probably null Het
Tdrd3 T A 14: 87,505,787 H390Q probably benign Het
Tlk2 T C 11: 105,253,359 probably null Het
Tnc G C 4: 63,976,556 P1531R probably damaging Het
Tnfrsf1b C A 4: 145,246,757 Q15H probably damaging Het
Tnfrsf1b T G 4: 145,246,758 Q15P possibly damaging Het
Tssk4 A T 14: 55,651,809 E264V probably damaging Het
Ttc37 T G 13: 76,185,113 probably null Het
Ugt3a2 G A 15: 9,365,188 V296I probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r8 T G 5: 108,799,263 E541A probably benign Het
Ybx1 A T 4: 119,278,938 probably benign Het
Zfp39 T A 11: 58,891,231 Y235F possibly damaging Het
Zfp422 T A 6: 116,626,943 K32* probably null Het
Zpbp2 T A 11: 98,551,324 probably null Het
Other mutations in Cd74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cd74 APN 18 60811326 missense probably benign 0.02
IGL01475:Cd74 APN 18 60810321 unclassified probably benign
IGL01867:Cd74 APN 18 60808280 missense probably benign 0.03
IGL03207:Cd74 APN 18 60811924 unclassified probably benign
R0010:Cd74 UTSW 18 60803896 start gained probably benign
R0010:Cd74 UTSW 18 60809071 missense probably benign 0.06
R0010:Cd74 UTSW 18 60809071 missense probably benign 0.06
R0416:Cd74 UTSW 18 60811414 missense possibly damaging 0.90
R0652:Cd74 UTSW 18 60811885 missense probably damaging 1.00
R1433:Cd74 UTSW 18 60803992 missense probably benign 0.04
R1490:Cd74 UTSW 18 60811366 missense probably damaging 1.00
R1762:Cd74 UTSW 18 60811318 missense probably benign 0.00
R1869:Cd74 UTSW 18 60810412 missense probably benign 0.18
R5433:Cd74 UTSW 18 60807921 missense probably benign 0.21
R5513:Cd74 UTSW 18 60811305 missense probably damaging 1.00
R6073:Cd74 UTSW 18 60811486 critical splice donor site probably null
R6381:Cd74 UTSW 18 60811363 missense probably damaging 1.00
R7394:Cd74 UTSW 18 60803893 start gained probably benign
R8944:Cd74 UTSW 18 60810055 missense probably damaging 1.00
R9252:Cd74 UTSW 18 60808292 missense possibly damaging 0.50
R9256:Cd74 UTSW 18 60811294 missense probably benign 0.03
X0011:Cd74 UTSW 18 60811487 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTATTGGGAAGGCTCTGAC -3'
(R):5'- TAGGGGATGGACTGTACGCAAC -3'

Sequencing Primer
(F):5'- AAGGCTCTGACAAGCTTCTG -3'
(R):5'- TGTACGCAACAGTTAAGGACC -3'
Posted On 2016-04-27