Incidental Mutation 'R4958:Sulf1'
ID381689
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12796910 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 106 (Y106C)
Ref Sequence ENSEMBL: ENSMUSP00000136014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051]
Predicted Effect probably benign
Transcript: ENSMUST00000088585
AA Change: Y106C

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918
AA Change: Y106C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177608
AA Change: Y106C

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918
AA Change: Y106C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180062
AA Change: Y106C

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918
AA Change: Y106C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186051
AA Change: Y106C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918
AA Change: Y106C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.4e-56 PFAM
Pfam:Phosphodiest 61 323 9.6e-8 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 1.1e-48 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187376
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0083:Sulf1 UTSW 1 12817417 missense probably damaging 0.99
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1946:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4488:Sulf1 UTSW 1 12786515 start gained probably benign
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5909:Sulf1 UTSW 1 12858815 missense possibly damaging 0.94
R5912:Sulf1 UTSW 1 12786752 unclassified probably benign
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R6880:Sulf1 UTSW 1 12842755 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7255:Sulf1 UTSW 1 12859008 missense probably benign 0.00
R7275:Sulf1 UTSW 1 12850965 splice site probably null
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
R7611:Sulf1 UTSW 1 12836243 missense probably benign
R7732:Sulf1 UTSW 1 12842789 missense probably benign 0.11
R7796:Sulf1 UTSW 1 12858820 missense probably benign 0.27
R7898:Sulf1 UTSW 1 12805294 missense probably damaging 1.00
R7984:Sulf1 UTSW 1 12859273 missense probably benign 0.00
R8003:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACAGCGCTATCTAAATGAC -3'
(R):5'- TGTTGAGTCTCCTGGAACTTC -3'

Sequencing Primer
(F):5'- GTGTTTTGCTAACCAGTGTCAGACC -3'
(R):5'- ATTACCCAGTGCAGTTCC -3'
Posted On2016-04-27