Incidental Mutation 'R4958:Atp1a4'
ID 381691
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene Name ATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission 042555-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4958 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 172051080-172085981 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 172058718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 909 (D909V)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
AlphaFold Q9WV27
Predicted Effect probably damaging
Transcript: ENSMUST00000111243
AA Change: D909V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: D909V

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,722 (GRCm39) S81G probably benign Het
Arel1 T C 12: 84,973,078 (GRCm39) K573R possibly damaging Het
Atf7ip C T 6: 136,583,808 (GRCm39) R1280C probably damaging Het
Cdh2 T G 18: 16,760,622 (GRCm39) probably null Het
Col6a1 A T 10: 76,559,339 (GRCm39) I99N probably damaging Het
Dennd4c A G 4: 86,699,916 (GRCm39) T256A probably damaging Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ereg T C 5: 91,237,970 (GRCm39) V152A probably damaging Het
Gm4950 T C 18: 51,998,641 (GRCm39) T105A probably benign Het
Hsf2 T C 10: 57,377,467 (GRCm39) I121T probably damaging Het
Kmt2a A T 9: 44,759,764 (GRCm39) L728Q probably damaging Het
Llgl1 G T 11: 60,602,261 (GRCm39) R768L probably benign Het
Lyst A G 13: 13,810,048 (GRCm39) I573V probably benign Het
Macf1 G T 4: 123,369,157 (GRCm39) T303K probably damaging Het
Map3k5 A T 10: 19,899,535 (GRCm39) Q264L possibly damaging Het
Mboat1 T C 13: 30,408,376 (GRCm39) S180P probably damaging Het
Mfsd6 T C 1: 52,700,183 (GRCm39) D655G probably damaging Het
Myh2 A G 11: 67,083,785 (GRCm39) E1521G possibly damaging Het
Nsd2 T A 5: 34,049,366 (GRCm39) S1200R probably damaging Het
Or51k2 T C 7: 103,595,808 (GRCm39) F12L probably damaging Het
Or52n2b T C 7: 104,565,668 (GRCm39) I278M probably damaging Het
Or6z3 G A 7: 6,464,057 (GRCm39) C183Y probably damaging Het
Or8h9 T C 2: 86,789,449 (GRCm39) M118V possibly damaging Het
Pbrm1 T C 14: 30,796,784 (GRCm39) I875T probably damaging Het
Pla2g1b T A 5: 115,608,885 (GRCm39) F26I probably damaging Het
Plscr4 A G 9: 92,366,814 (GRCm39) N143D possibly damaging Het
Rab11fip1 G T 8: 27,644,841 (GRCm39) R315S probably damaging Het
Rptor G A 11: 119,748,217 (GRCm39) R727Q probably benign Het
Serac1 A T 17: 6,119,657 (GRCm39) V91D probably benign Het
Slco1a6 C A 6: 142,091,431 (GRCm39) G90C probably damaging Het
Sulf1 A G 1: 12,867,134 (GRCm39) Y106C probably benign Het
Syt13 G A 2: 92,783,794 (GRCm39) V355M probably damaging Het
Tjp1 G A 7: 64,985,850 (GRCm39) R314* probably null Het
Tshr A G 12: 91,504,961 (GRCm39) D633G probably damaging Het
Usp5 C G 6: 124,799,593 (GRCm39) K318N possibly damaging Het
Znrf4 A G 17: 56,818,701 (GRCm39) F202S probably damaging Het
Zswim8 T A 14: 20,763,533 (GRCm39) W427R probably damaging Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172,067,373 (GRCm39) missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172,074,339 (GRCm39) missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172,085,474 (GRCm39) missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172,074,291 (GRCm39) missense probably benign
IGL02156:Atp1a4 APN 1 172,085,529 (GRCm39) missense probably benign
IGL02170:Atp1a4 APN 1 172,062,103 (GRCm39) missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172,082,452 (GRCm39) missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172,062,642 (GRCm39) missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172,078,973 (GRCm39) missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172,054,866 (GRCm39) critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172,071,653 (GRCm39) missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172,058,718 (GRCm39) missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172,067,664 (GRCm39) missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172,067,664 (GRCm39) missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172,085,468 (GRCm39) missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172,062,554 (GRCm39) missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172,067,255 (GRCm39) splice site probably benign
R0615:Atp1a4 UTSW 1 172,059,627 (GRCm39) splice site probably benign
R0730:Atp1a4 UTSW 1 172,067,774 (GRCm39) splice site probably benign
R1412:Atp1a4 UTSW 1 172,059,576 (GRCm39) missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172,082,470 (GRCm39) missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172,062,615 (GRCm39) missense probably damaging 0.99
R1968:Atp1a4 UTSW 1 172,067,731 (GRCm39) missense probably benign
R2291:Atp1a4 UTSW 1 172,072,473 (GRCm39) missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172,074,257 (GRCm39) missense probably damaging 1.00
R2908:Atp1a4 UTSW 1 172,062,044 (GRCm39) missense probably benign
R3119:Atp1a4 UTSW 1 172,067,393 (GRCm39) missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172,061,528 (GRCm39) missense probably damaging 1.00
R4447:Atp1a4 UTSW 1 172,061,998 (GRCm39) missense probably damaging 0.99
R4602:Atp1a4 UTSW 1 172,067,332 (GRCm39) missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172,062,567 (GRCm39) missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172,085,223 (GRCm39) missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172,085,223 (GRCm39) missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172,081,677 (GRCm39) nonsense probably null
R5015:Atp1a4 UTSW 1 172,081,649 (GRCm39) missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172,059,572 (GRCm39) missense probably damaging 1.00
R5234:Atp1a4 UTSW 1 172,054,737 (GRCm39) missense possibly damaging 0.73
R5501:Atp1a4 UTSW 1 172,074,399 (GRCm39) missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172,081,730 (GRCm39) missense probably damaging 0.99
R5872:Atp1a4 UTSW 1 172,071,975 (GRCm39) missense probably damaging 1.00
R5933:Atp1a4 UTSW 1 172,059,841 (GRCm39) missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172,085,617 (GRCm39) unclassified probably benign
R7087:Atp1a4 UTSW 1 172,074,269 (GRCm39) missense probably damaging 1.00
R7122:Atp1a4 UTSW 1 172,059,503 (GRCm39) missense possibly damaging 0.47
R7381:Atp1a4 UTSW 1 172,067,682 (GRCm39) missense possibly damaging 0.70
R7431:Atp1a4 UTSW 1 172,078,474 (GRCm39) missense probably benign 0.31
R8269:Atp1a4 UTSW 1 172,059,892 (GRCm39) missense probably damaging 1.00
R8400:Atp1a4 UTSW 1 172,062,061 (GRCm39) missense probably damaging 1.00
R8559:Atp1a4 UTSW 1 172,078,897 (GRCm39) missense probably damaging 1.00
R8680:Atp1a4 UTSW 1 172,078,566 (GRCm39) missense probably damaging 1.00
R8777:Atp1a4 UTSW 1 172,059,869 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Atp1a4 UTSW 1 172,059,869 (GRCm39) missense probably damaging 1.00
R8867:Atp1a4 UTSW 1 172,072,491 (GRCm39) missense probably damaging 0.99
R8869:Atp1a4 UTSW 1 172,054,690 (GRCm39) missense probably benign
R9260:Atp1a4 UTSW 1 172,074,359 (GRCm39) missense probably damaging 1.00
R9300:Atp1a4 UTSW 1 172,067,398 (GRCm39) missense probably damaging 1.00
R9545:Atp1a4 UTSW 1 172,078,464 (GRCm39) missense probably benign 0.35
Z1176:Atp1a4 UTSW 1 172,059,521 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGGTGGTCAACTGGCTGAAG -3'
(R):5'- ACCATTCTCTGAACAGACTCTC -3'

Sequencing Primer
(F):5'- GCTGAAGCCACAGTGTATATTAAAAG -3'
(R):5'- TGAACAGACTCTCCTCCCTGAC -3'
Posted On 2016-04-27