Incidental Mutation 'R4958:Syt13'
ID381693
Institutional Source Beutler Lab
Gene Symbol Syt13
Ensembl Gene ENSMUSG00000027220
Gene Namesynaptotagmin XIII
Synonyms
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location92915098-92956058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92953449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 355 (V355M)
Ref Sequence ENSEMBL: ENSMUSP00000028648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028648]
Predicted Effect probably damaging
Transcript: ENSMUST00000028648
AA Change: V355M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028648
Gene: ENSMUSG00000027220
AA Change: V355M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
Pfam:C2 165 277 5e-8 PFAM
C2 303 419 7.86e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the large synaptotagmin protein family. Family members have an extracellular N-terminal transmembrane domain and a cytoplasmic C terminus with two tandem C2 domains (C2A and C2B). Synaptotogmin family members can form homo- and heteromeric complexes with each other. They also have different biochemical properties and developmental profiles, and patterns of tissue distribution. Synaptotagmins function as membrane traffickers in multicellular organisms. Two alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Syt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02236:Syt13 APN 2 92940865 missense probably damaging 0.96
IGL02332:Syt13 APN 2 92940804 missense probably benign 0.02
IGL03015:Syt13 APN 2 92951380 missense possibly damaging 0.94
R0345:Syt13 UTSW 2 92946067 missense possibly damaging 0.66
R0367:Syt13 UTSW 2 92915251 missense probably benign 0.01
R1160:Syt13 UTSW 2 92943042 splice site probably null
R1635:Syt13 UTSW 2 92953415 missense probably damaging 1.00
R1639:Syt13 UTSW 2 92945971 missense probably benign 0.04
R1844:Syt13 UTSW 2 92940820 missense probably damaging 1.00
R1869:Syt13 UTSW 2 92946103 missense possibly damaging 0.90
R2032:Syt13 UTSW 2 92953401 missense probably damaging 1.00
R2306:Syt13 UTSW 2 92940967 missense probably benign 0.04
R2375:Syt13 UTSW 2 92946151 missense probably benign 0.02
R5341:Syt13 UTSW 2 92953552 missense probably benign 0.00
R7605:Syt13 UTSW 2 92943133 missense probably benign 0.27
R7921:Syt13 UTSW 2 92953646 missense probably damaging 0.99
R8198:Syt13 UTSW 2 92953554 missense probably damaging 1.00
X0024:Syt13 UTSW 2 92943075 missense probably benign 0.00
Z1176:Syt13 UTSW 2 92940766 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATCTCTAGACCGGTTCCTG -3'
(R):5'- TTAGCATCTCCTCCCAGTGG -3'

Sequencing Primer
(F):5'- TACTGTTGAGAGAATGCACGGTCC -3'
(R):5'- AGTGGCTGCGCTCAGAG -3'
Posted On2016-04-27