Incidental Mutation 'R4958:Ereg'
ID381698
Institutional Source Beutler Lab
Gene Symbol Ereg
Ensembl Gene ENSMUSG00000029377
Gene Nameepiregulin
SynonymsEPR
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location91074622-91093646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91090111 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 152 (V152A)
Ref Sequence ENSEMBL: ENSMUSP00000031324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031324]
Predicted Effect probably damaging
Transcript: ENSMUST00000031324
AA Change: V152A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031324
Gene: ENSMUSG00000029377
AA Change: V152A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 60 97 2.9e-2 SMART
transmembrane domain 112 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted peptide hormone and member of the epidermal growth factor (EGF) family of proteins. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and the structurally related erb-b2 receptor tyrosine kinase 4 (ERBB4). The encoded protein may be involved in a wide range of biological processes including inflammation, wound healing, oocyte maturation, and cell proliferation. Additionally, the encoded protein may promote the progression of cancers of various human tissues. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice for one allele develop chronic dermatitis. Homozygous null mice for another allele display increased sensitivity to dextran sulfate sodium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Ereg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ereg APN 5 91074779 missense probably benign
IGL01643:Ereg APN 5 91086778 missense probably benign 0.10
IGL01927:Ereg APN 5 91086812 missense probably damaging 1.00
IGL03355:Ereg APN 5 91088581 splice site probably benign
I0000:Ereg UTSW 5 91089209 missense probably benign 0.08
R0245:Ereg UTSW 5 91074800 missense possibly damaging 0.73
R4366:Ereg UTSW 5 91086800 missense probably benign 0.21
R5422:Ereg UTSW 5 91074807 critical splice donor site probably null
R5911:Ereg UTSW 5 91074693 utr 5 prime probably benign
R6838:Ereg UTSW 5 91088464 missense probably benign 0.00
R8356:Ereg UTSW 5 91090134 missense possibly damaging 0.58
R8456:Ereg UTSW 5 91090134 missense possibly damaging 0.58
X0009:Ereg UTSW 5 91090084 missense probably benign 0.29
Z1176:Ereg UTSW 5 91090120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTAAACGGTTGGACAATGGG -3'
(R):5'- CTCTCTAAGCACTGCATCAGC -3'

Sequencing Primer
(F):5'- GGGACACCGTTCTCTTGC -3'
(R):5'- CTCTAAGCACTGCATCAGCTTAATG -3'
Posted On2016-04-27