Incidental Mutation 'R4958:Pla2g1b'
ID381699
Institutional Source Beutler Lab
Gene Symbol Pla2g1b
Ensembl Gene ENSMUSG00000029522
Gene Namephospholipase A2, group IB, pancreas
SynonymsPla2a, sPLA2IB
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115466262-115474722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115470826 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 26 (F26I)
Ref Sequence ENSEMBL: ENSMUSP00000120743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031495] [ENSMUST00000112071] [ENSMUST00000125568] [ENSMUST00000145785]
Predicted Effect probably damaging
Transcript: ENSMUST00000031495
AA Change: F27I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031495
Gene: ENSMUSG00000029522
AA Change: F27I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 146 1.34e-66 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112071
AA Change: F27I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107702
Gene: ENSMUSG00000029522
AA Change: F27I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 82 2.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125568
AA Change: F26I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120743
Gene: ENSMUSG00000029522
AA Change: F26I

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PA2c 22 124 2.58e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145785
AA Change: F27I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138683
Gene: ENSMUSG00000029522
AA Change: F27I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 76 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202822
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted member of the phospholipase A2 (PLA2) class of enzymes, which is produced by the pancreatic acinar cells. The encoded calcium-dependent enzyme catalyzes the hydrolysis of the sn-2 position of membrane glycerophospholipids to release arachidonic acid (AA) and lysophospholipids. AA is subsequently converted by downstream metabolic enzymes to several bioactive lipophilic compounds (eicosanoids), including prostaglandins (PGs) and leukotrienes (LTs). The enzyme may be involved in several physiological processes including cell contraction, cell proliferation and pathological response. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in lipid absorption, increased insulin sensitivity and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Pla2g1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03282:Pla2g1b APN 5 115470880 missense probably damaging 0.99
IGL03367:Pla2g1b APN 5 115472114 missense probably damaging 1.00
R4401:Pla2g1b UTSW 5 115470888 nonsense probably null
R4402:Pla2g1b UTSW 5 115470888 nonsense probably null
R4403:Pla2g1b UTSW 5 115470888 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTCGACTTAGCTCCAAGATC -3'
(R):5'- AGACGAGATGTGATTGGCCG -3'

Sequencing Primer
(F):5'- CACATTAGTAGGCTTCTGGGAAC -3'
(R):5'- AGATGTGATTGGCCGGTTCTC -3'
Posted On2016-04-27