Incidental Mutation 'R4958:Ankrd7'
ID381700
Institutional Source Beutler Lab
Gene Symbol Ankrd7
Ensembl Gene ENSMUSG00000029517
Gene Nameankyrin repeat domain 7
Synonyms
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location18866318-18879586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18866723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 81 (S81G)
Ref Sequence ENSEMBL: ENSMUSP00000111054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031489] [ENSMUST00000115396]
Predicted Effect probably benign
Transcript: ENSMUST00000031489
AA Change: S81G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031489
Gene: ENSMUSG00000029517
AA Change: S81G

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
ANK 80 109 1.06e-4 SMART
ANK 113 142 5.45e-2 SMART
ANK 146 175 6.92e-4 SMART
ANK 179 208 1.94e-7 SMART
ANK 212 241 1.99e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115396
AA Change: S81G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111054
Gene: ENSMUSG00000029517
AA Change: S81G

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
ANK 80 109 1.06e-4 SMART
ANK 113 143 3.07e2 SMART
ANK 147 176 6.92e-4 SMART
ANK 180 209 1.94e-7 SMART
ANK 213 242 1.99e2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Ankrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Ankrd7 APN 6 18879346 missense probably damaging 0.99
IGL01336:Ankrd7 APN 6 18868278 missense probably benign 0.05
IGL01916:Ankrd7 APN 6 18868251 missense possibly damaging 0.65
IGL02398:Ankrd7 APN 6 18866697 missense probably damaging 0.99
R0031:Ankrd7 UTSW 6 18870008 nonsense probably null
R0157:Ankrd7 UTSW 6 18866540 missense probably damaging 0.98
R0207:Ankrd7 UTSW 6 18870031 missense probably benign 0.09
R2154:Ankrd7 UTSW 6 18870031 missense probably benign 0.09
R4255:Ankrd7 UTSW 6 18869881 splice site probably null
R4581:Ankrd7 UTSW 6 18868021 missense probably damaging 0.99
R4582:Ankrd7 UTSW 6 18868021 missense probably damaging 0.99
R5194:Ankrd7 UTSW 6 18868077 missense possibly damaging 0.67
R6077:Ankrd7 UTSW 6 18868072 missense probably benign 0.08
R6731:Ankrd7 UTSW 6 18866654 missense probably damaging 1.00
R6898:Ankrd7 UTSW 6 18868101 splice site probably null
R7170:Ankrd7 UTSW 6 18868390 nonsense probably null
R7194:Ankrd7 UTSW 6 18879343 missense probably benign 0.00
R7749:Ankrd7 UTSW 6 18879516 splice site probably null
R8348:Ankrd7 UTSW 6 18868008 missense probably damaging 0.96
R8383:Ankrd7 UTSW 6 18868411 missense possibly damaging 0.86
RF012:Ankrd7 UTSW 6 18869275 missense possibly damaging 0.76
Z1177:Ankrd7 UTSW 6 18866564 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAGGAAGACAGATGATTCCCAC -3'
(R):5'- ACATGCGCAAGTTAAGGAGC -3'

Sequencing Primer
(F):5'- CTCAGAAGTGCCCATTAGCCTG -3'
(R):5'- GCCAAAACCTATGTGTGACCCTATG -3'
Posted On2016-04-27