Incidental Mutation 'R4958:Usp5'
ID381701
Institutional Source Beutler Lab
Gene Symbol Usp5
Ensembl Gene ENSMUSG00000038429
Gene Nameubiquitin specific peptidase 5 (isopeptidase T)
SynonymsUcht
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124815019-124829484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 124822630 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 318 (K318N)
Ref Sequence ENSEMBL: ENSMUSP00000041299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000142058] [ENSMUST00000153306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047510
AA Change: K318N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 656 694 3.12e-7 SMART
UBA 724 761 8.63e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122110
AA Change: K318N

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 633 671 3.12e-7 SMART
UBA 701 738 8.63e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141042
Predicted Effect possibly damaging
Transcript: ENSMUST00000142058
AA Change: K300N

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429
AA Change: K300N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-20 BLAST
ZnF_UBP 180 235 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146098
Predicted Effect probably benign
Transcript: ENSMUST00000153306
SMART Domains Protein: ENSMUSP00000118200
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
Blast:ZnF_UBP 1 32 3e-7 BLAST
ZnF_UBP 152 207 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154189
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Usp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp5 APN 6 124829353 missense probably benign 0.00
IGL00905:Usp5 APN 6 124815613 missense probably damaging 1.00
IGL01584:Usp5 APN 6 124819387 missense probably damaging 1.00
IGL01642:Usp5 APN 6 124820453 missense probably damaging 0.99
IGL01787:Usp5 APN 6 124824226 missense possibly damaging 0.95
IGL02394:Usp5 APN 6 124822709 missense probably damaging 1.00
IGL02677:Usp5 APN 6 124819426 missense probably damaging 1.00
IGL03392:Usp5 APN 6 124826387 missense probably damaging 1.00
BB004:Usp5 UTSW 6 124824229 missense probably benign 0.06
BB014:Usp5 UTSW 6 124824229 missense probably benign 0.06
R0594:Usp5 UTSW 6 124817424 missense probably damaging 0.99
R1522:Usp5 UTSW 6 124825166 missense probably benign
R1719:Usp5 UTSW 6 124823460 missense possibly damaging 0.94
R2185:Usp5 UTSW 6 124817410 missense probably damaging 0.99
R3115:Usp5 UTSW 6 124815597 missense probably damaging 1.00
R4196:Usp5 UTSW 6 124824938 missense possibly damaging 0.78
R4347:Usp5 UTSW 6 124821195 missense probably damaging 1.00
R4386:Usp5 UTSW 6 124818474 critical splice donor site probably null
R4500:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4501:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4526:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4527:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4528:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4684:Usp5 UTSW 6 124817956 missense probably damaging 1.00
R4912:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4913:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4954:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4956:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4957:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R5071:Usp5 UTSW 6 124826379 missense probably benign 0.13
R6020:Usp5 UTSW 6 124817613 unclassified probably benign
R6236:Usp5 UTSW 6 124818478 missense probably benign 0.05
R6370:Usp5 UTSW 6 124820428 missense probably benign 0.01
R7090:Usp5 UTSW 6 124829394 start codon destroyed probably null
R7317:Usp5 UTSW 6 124826318 missense probably damaging 0.98
R7447:Usp5 UTSW 6 124821114 missense probably damaging 1.00
R7572:Usp5 UTSW 6 124818007 missense probably damaging 0.99
R7598:Usp5 UTSW 6 124826379 missense possibly damaging 0.73
R7927:Usp5 UTSW 6 124824229 missense probably benign 0.06
R7931:Usp5 UTSW 6 124824446 intron probably benign
R8089:Usp5 UTSW 6 124820410 critical splice donor site probably null
R8361:Usp5 UTSW 6 124824985 missense probably damaging 1.00
X0058:Usp5 UTSW 6 124824176 missense probably damaging 1.00
Z1177:Usp5 UTSW 6 124825148 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCATGGCCCTCCTTAAGTAATGC -3'
(R):5'- AGGATGAGTCTTAGTCCAGAGC -3'

Sequencing Primer
(F):5'- GGCCCTCCTTAAGTAATGCTAAAATG -3'
(R):5'- TCTTAGTCCAGAGCTTAGAGACG -3'
Posted On2016-04-27