Incidental Mutation 'R4958:Slco1a6'
ID381703
Institutional Source Beutler Lab
Gene Symbol Slco1a6
Ensembl Gene ENSMUSG00000079262
Gene Namesolute carrier organic anion transporter family, member 1a6
SynonymsSlc21a13, organic anion-transporting polypeptide, 4930422F19Rik, Oatp-5
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142085761-142208521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142145705 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 90 (G90C)
Ref Sequence ENSEMBL: ENSMUSP00000107458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111827]
Predicted Effect probably damaging
Transcript: ENSMUST00000111827
AA Change: G90C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107458
Gene: ENSMUSG00000079262
AA Change: G90C

DomainStartEndE-ValueType
Pfam:MFS_1 21 421 7.8e-26 PFAM
Pfam:OATP 21 597 1.3e-163 PFAM
Pfam:Kazal_2 445 486 2.7e-11 PFAM
transmembrane domain 600 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173877
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Slco1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Slco1a6 APN 6 142161017 missense probably benign 0.00
IGL00430:Slco1a6 APN 6 142101651 nonsense probably null
IGL00541:Slco1a6 APN 6 142096299 missense possibly damaging 0.67
IGL01340:Slco1a6 APN 6 142109383 missense possibly damaging 0.71
IGL01693:Slco1a6 APN 6 142133209 nonsense probably null
IGL01713:Slco1a6 APN 6 142086567 missense possibly damaging 0.87
IGL01828:Slco1a6 APN 6 142096411 missense probably damaging 1.00
IGL02049:Slco1a6 APN 6 142101583 splice site probably benign
IGL02085:Slco1a6 APN 6 142086474 missense probably benign 0.00
IGL02245:Slco1a6 APN 6 142109424 missense probably damaging 1.00
IGL02549:Slco1a6 APN 6 142096415 splice site probably benign
IGL02698:Slco1a6 APN 6 142103011 nonsense probably null
IGL02948:Slco1a6 APN 6 142133235 splice site probably null
IGL03075:Slco1a6 APN 6 142103149 splice site probably benign
PIT4585001:Slco1a6 UTSW 6 142109520 missense probably damaging 0.99
R0008:Slco1a6 UTSW 6 142157222 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0173:Slco1a6 UTSW 6 142103122 missense probably benign 0.10
R1642:Slco1a6 UTSW 6 142086434 missense probably benign 0.00
R1939:Slco1a6 UTSW 6 142133230 missense probably damaging 1.00
R2256:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2257:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2696:Slco1a6 UTSW 6 142112936 missense probably damaging 1.00
R2902:Slco1a6 UTSW 6 142096320 missense probably damaging 1.00
R4602:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4611:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R5256:Slco1a6 UTSW 6 142132701 missense probably benign 0.39
R5347:Slco1a6 UTSW 6 142086599 missense probably damaging 0.98
R6130:Slco1a6 UTSW 6 142086429 missense probably benign 0.26
R6384:Slco1a6 UTSW 6 142109379 missense probably benign 0.01
R6543:Slco1a6 UTSW 6 142133146 missense probably benign 0.00
R6662:Slco1a6 UTSW 6 142133215 missense probably damaging 0.97
R6687:Slco1a6 UTSW 6 142099350 missense possibly damaging 0.91
R6702:Slco1a6 UTSW 6 142103100 missense probably damaging 0.99
R7012:Slco1a6 UTSW 6 142086561 missense probably benign 0.02
R7140:Slco1a6 UTSW 6 142103019 missense probably benign 0.00
R7392:Slco1a6 UTSW 6 142157277 missense probably benign 0.00
R7399:Slco1a6 UTSW 6 142091068 missense probably benign 0.01
R7476:Slco1a6 UTSW 6 142103001 missense possibly damaging 0.71
R7621:Slco1a6 UTSW 6 142161017 missense probably damaging 0.96
R7633:Slco1a6 UTSW 6 142145755 missense probably damaging 1.00
R8139:Slco1a6 UTSW 6 142089900 missense probably damaging 1.00
R8177:Slco1a6 UTSW 6 142101734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACTCAGGGGAAAGTAATCCAG -3'
(R):5'- CAGGAGGGTTATAATGTCTGGAC -3'

Sequencing Primer
(F):5'- GCAGAACTTGACAGTTTCTGCCATG -3'
(R):5'- ACAAAACAAAACAACAACAAACCTC -3'
Posted On2016-04-27